EMAIL THIS PAGE TO A FRIEND

CSPG4P5

chondroitin sulfate proteoglycan 4 pseudogene 5

11 Gene Product Result for
Species: Human CSPG4P5(114817)
UniProtKB ID: Q96PW8
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_052919 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052919 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052919 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU222381 MISSION® esiRNA esiRNA targeting human CSPG4P5 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052919 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052919 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00175834 predicted 6527
2 SASI_Hs01_00175835 predicted 6523
3 SASI_Hs01_00175836 predicted 5642
4 SASI_Hs01_00175837 predicted 5895
5 SASI_Hs01_00175838 predicted 5759
6 SASI_Hs01_00175839 predicted 5168
7 SASI_Hs01_00175840 predicted 6372
8 SASI_Hs01_00175841 predicted 6522
9 SASI_Hs01_00175842 predicted 6051
10 SASI_Hs01_00175843 predicted 6532
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052919
CSPG4P5 MISSION shRNA Bacterial Glycerol Stock
chondroitin sulfate proteoglycan 4 pseudogene 5
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052919.1-6091s1c1
Sequence:CCGGGCAACTTTCAACTACAGGGCACTCGAGTGCCCTGTAGTTGAAAGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052919.1-6086s1c1
Sequence:CCGGGAAAGGCAACTTTCAACTACACTCGAGTGTAGTTGAAAGTTGCCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052919.1-5279s1c1
Sequence:CCGGCCTTATGGTGATCCTGGAACACTCGAGTGTTCCAGGATCACCATAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052919.1-6383s1c1
Sequence:CCGGCAGGTACCTCTATGAGGTCATCTCGAGATGACCTCATAGAGGTACCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052919.1-5472s1c1
Sequence:CCGGCTAGTCTATGTCCACTGTGGTCTCGAGACCACAGTGGACATAGACTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052919
CSPG4P5 MISSION shRNA shRNA Plasmid DNA
chondroitin sulfate proteoglycan 4 pseudogene 5
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052919.1-6091s1c1
Sequence:CCGGGCAACTTTCAACTACAGGGCACTCGAGTGCCCTGTAGTTGAAAGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052919.1-6086s1c1
Sequence:CCGGGAAAGGCAACTTTCAACTACACTCGAGTGTAGTTGAAAGTTGCCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052919.1-5279s1c1
Sequence:CCGGCCTTATGGTGATCCTGGAACACTCGAGTGTTCCAGGATCACCATAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052919.1-6383s1c1
Sequence:CCGGCAGGTACCTCTATGAGGTCATCTCGAGATGACCTCATAGAGGTACCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052919.1-5472s1c1
Sequence:CCGGCTAGTCTATGTCCACTGTGGTCTCGAGACCACAGTGGACATAGACTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052919
CSPG4P5 MISSION shRNA Lentiviral Transduction Particles
chondroitin sulfate proteoglycan 4 pseudogene 5
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052919.1-6091s1c1
Sequence:CCGGGCAACTTTCAACTACAGGGCACTCGAGTGCCCTGTAGTTGAAAGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052919.1-6086s1c1
Sequence:CCGGGAAAGGCAACTTTCAACTACACTCGAGTGTAGTTGAAAGTTGCCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052919.1-5279s1c1
Sequence:CCGGCCTTATGGTGATCCTGGAACACTCGAGTGTTCCAGGATCACCATAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052919.1-6383s1c1
Sequence:CCGGCAGGTACCTCTATGAGGTCATCTCGAGATGACCTCATAGAGGTACCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052919.1-5472s1c1
Sequence:CCGGCTAGTCTATGTCCACTGTGGTCTCGAGACCACAGTGGACATAGACTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)