EMAIL THIS PAGE TO A FRIEND

CST3

cystatin C

73 Gene Product Result for
Synonyms: ARMD11
UniProtKB ID: P01034, B2R5J9, D3DW42, Q6FGW9
Gene ID:
Human(1471) Summary: The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins and the kininogens. The type 2 cystatin proteins are a class of cysteine proteinase inhibitors found in a variety of human fluids and secretions, where they appear to provide protective functions. The cystatin locus on chromosome 20 contains the majority of the type 2 cystatin genes and pseudogenes. This gene is located in the cystatin locus and encodes the most abundant extracellular inhibitor of cysteine proteases, which is found in high concentrations in biological fluids and is expressed in virtually all organs of the body. A mutation in this gene has been associated with amyloid angiopathy. Expression of this protein in vascular wall smooth muscle cells is severely reduced in both atherosclerotic and aneurysmal aortic lesions, establishing its role in vascular disease. [provided by RefSeq, Jul 2008]
Mouse(13010) cystatin C
Rat(25307) cystatin C
Zebrafish(791878) cystatin C (amyloid angiopathy and cerebral hemorrhage)
chicken(396497) cystatin C
cow(281102) cystatin C
sheep(101104079) cystatin C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2501239 Anti-CST3 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
SAB2700368 Anti-Cst3 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse
western blot pricing
HPA013143 Anti-CST3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB1401095 Anti-CST3 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB2500286 Anti-Cystatin 3 antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse
ELISA, western blot pricing
SAB1402739 Monoclonal Anti-CST3 antibody produced in mouse clone 1H4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB4100452 Monoclonal Anti-CST3 antibody produced in mouse clone CST3-A389, culture supernatant human
western blot pricing
SAB4100486 Monoclonal Anti-CST3 antibody produced in mouse clone CST3-B389, culture supernatant human
western blot pricing
SAB4100533 Monoclonal Anti-CST3 antibody produced in mouse clone CST3-A481, culture supernatant human
western blot pricing
SAB1408907 Monoclonal Anti-CST3 antibody produced in mouse clone 2G4, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1408908 Monoclonal Anti-CST3 antibody produced in mouse clone 3D10, purified immunoglobulin, buffered aqueous solution human
ELISA pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000099 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000099 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000099 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009976 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009976 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009976 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000099 Rosetta Predictions human pricing
NM_012837 Rosetta Predictions rat pricing
NM_009976 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000099 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027550 predicted 257
2 SASI_Hs01_00027546 predicted 532
3 SASI_Hs01_00027547 predicted 470
4 SASI_Hs01_00027548 predicted 471
5 SASI_Hs01_00027549 predicted 428
6 SASI_Hs01_00027551 predicted 532
7 SASI_Hs01_00027552 predicted 408
8 SASI_Hs01_00027553 predicted 354
9 SASI_Hs01_00027555 predicted 404
10 SASI_Hs02_00301867 predicted 474
11 SASI_Hs01_00027554 predicted 250
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012837 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00080576 predicted 323
2 SASI_Rn01_00080577 predicted 411
3 SASI_Rn01_00080578 predicted 350
4 SASI_Rn01_00080579 predicted 485
5 SASI_Rn01_00080580 predicted 494
6 SASI_Rn01_00080581 predicted 294
7 SASI_Rn01_00080582 predicted 494
8 SASI_Rn01_00080583 predicted 260
9 SASI_Rn01_00080584 predicted 363
10 SASI_Rn01_00080585 predicted 307
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009976 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00103104 predicted 366
2 SASI_Mm01_00103105 predicted 391
3 SASI_Mm02_00317567 predicted 346
4 SASI_Mm01_00103107 predicted 371
5 SASI_Mm01_00103108 predicted 386
6 SASI_Mm01_00103109 predicted 279
7 SASI_Mm01_00103110 predicted 230
8 SASI_Mm01_00103111 predicted 264
9 SASI_Mm01_00103113 predicted 356
10 SASI_Mm02_00317568 predicted 241
11 SASI_Mm01_00103106 predicted 438
12 SASI_Mm01_00103112 predicted 291
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000099
VALIDATED
CST3 MISSION shRNA Bacterial Glycerol Stock
cystatin C
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371933    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_000099.2-536s21c1
Sequence:CCGGCTGTGCCTATCACCTCTTATGCTCGAGCATAAGAGGTGATAGGCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_000099.2-477s21c1
Sequence:CCGGCACAATGACCTTGTCGAAATCCTCGAGGATTTCGACAAGGTCATTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000099.2-249s1c1
Sequence:CCGGCGAGTACAACAAAGCCAGCAACTCGAGTTGCTGGCTTTGTTGTACTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000099.2-258s1c1
Sequence:CCGGCAAAGCCAGCAACGACATGTACTCGAGTACATGTCGTTGCTGGCTTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000099.2-336s1c1
Sequence:CCGGCTACTTCTTGGACGTGGAGCTCTCGAGAGCTCCACGTCCAAGAAGTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000099.2-250s1c1
Sequence:CCGGGAGTACAACAAAGCCAGCAACCTCGAGGTTGCTGGCTTTGTTGTACTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000099.2-261s1c1
Sequence:CCGGAGCCAGCAACGACATGTACCACTCGAGTGGTACATGTCGTTGCTGGCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000099
VALIDATED
CST3 MISSION shRNA shRNA Plasmid DNA
cystatin C
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371933    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_000099.2-536s21c1
Sequence:CCGGCTGTGCCTATCACCTCTTATGCTCGAGCATAAGAGGTGATAGGCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_000099.2-477s21c1
Sequence:CCGGCACAATGACCTTGTCGAAATCCTCGAGGATTTCGACAAGGTCATTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000099.2-249s1c1
Sequence:CCGGCGAGTACAACAAAGCCAGCAACTCGAGTTGCTGGCTTTGTTGTACTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000099.2-258s1c1
Sequence:CCGGCAAAGCCAGCAACGACATGTACTCGAGTACATGTCGTTGCTGGCTTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000099.2-336s1c1
Sequence:CCGGCTACTTCTTGGACGTGGAGCTCTCGAGAGCTCCACGTCCAAGAAGTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000099.2-250s1c1
Sequence:CCGGGAGTACAACAAAGCCAGCAACCTCGAGGTTGCTGGCTTTGTTGTACTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000099.2-261s1c1
Sequence:CCGGAGCCAGCAACGACATGTACCACTCGAGTGGTACATGTCGTTGCTGGCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000099
VALIDATED
CST3 MISSION shRNA Lentiviral Transduction Particles
cystatin C
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371933    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_000099.2-536s21c1
Sequence:CCGGCTGTGCCTATCACCTCTTATGCTCGAGCATAAGAGGTGATAGGCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_000099.2-477s21c1
Sequence:CCGGCACAATGACCTTGTCGAAATCCTCGAGGATTTCGACAAGGTCATTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000099.2-249s1c1
Sequence:CCGGCGAGTACAACAAAGCCAGCAACTCGAGTTGCTGGCTTTGTTGTACTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000099.2-258s1c1
Sequence:CCGGCAAAGCCAGCAACGACATGTACTCGAGTACATGTCGTTGCTGGCTTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000099.2-336s1c1
Sequence:CCGGCTACTTCTTGGACGTGGAGCTCTCGAGAGCTCCACGTCCAAGAAGTAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000099.2-250s1c1
Sequence:CCGGGAGTACAACAAAGCCAGCAACCTCGAGGTTGCTGGCTTTGTTGTACTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000099.2-261s1c1
Sequence:CCGGAGCCAGCAACGACATGTACCACTCGAGTGGTACATGTCGTTGCTGGCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009976
VALIDATED
CST3 MISSION shRNA Bacterial Glycerol Stock
cystatin C
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000301320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009976.3-235s21c1
Sequence:CCGGCTTCGCTGTGAGCGAGTACAACTCGAGTTGTACTCGCTCACAGCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009976.3-319s21c1
Sequence:CCGGCGTGGCTGGAGTGAACTATTTCTCGAGAAATAGTTCACTCCAGCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009976.3-247s21c1
Sequence:CCGGCGAGTACAACAAGGGCAGCAACTCGAGTTGCTGCCCTTGTTGTACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009976.3-418s21c1
Sequence:CCGGCCATCTGATGAGGAAGGCACTCTCGAGAGTGCCTTCCTCATCAGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009976.2-320s1c1
Sequence:CCGGCGTGGCTGGAGTGAACTATTTCTCGAGAAATAGTTCACTCCAGCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009976.2-419s1c1
Sequence:CCGGCCATCTGATGAGGAAGGCACTCTCGAGAGTGCCTTCCTCATCAGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009976.2-236s1c1
Sequence:CCGGCTTCGCTGTGAGCGAGTACAACTCGAGTTGTACTCGCTCACAGCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009976.2-379s1c1
Sequence:CCGGCCCAGACAAATTTGACTGACTCTCGAGAGTCAGTCAAATTTGTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009976.2-248s1c1
Sequence:CCGGCGAGTACAACAAGGGCAGCAACTCGAGTTGCTGCCCTTGTTGTACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009976
VALIDATED
CST3 MISSION shRNA shRNA Plasmid DNA
cystatin C
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000301320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009976.3-235s21c1
Sequence:CCGGCTTCGCTGTGAGCGAGTACAACTCGAGTTGTACTCGCTCACAGCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009976.3-319s21c1
Sequence:CCGGCGTGGCTGGAGTGAACTATTTCTCGAGAAATAGTTCACTCCAGCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009976.3-247s21c1
Sequence:CCGGCGAGTACAACAAGGGCAGCAACTCGAGTTGCTGCCCTTGTTGTACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009976.3-418s21c1
Sequence:CCGGCCATCTGATGAGGAAGGCACTCTCGAGAGTGCCTTCCTCATCAGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009976.2-320s1c1
Sequence:CCGGCGTGGCTGGAGTGAACTATTTCTCGAGAAATAGTTCACTCCAGCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009976.2-419s1c1
Sequence:CCGGCCATCTGATGAGGAAGGCACTCTCGAGAGTGCCTTCCTCATCAGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009976.2-236s1c1
Sequence:CCGGCTTCGCTGTGAGCGAGTACAACTCGAGTTGTACTCGCTCACAGCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009976.2-379s1c1
Sequence:CCGGCCCAGACAAATTTGACTGACTCTCGAGAGTCAGTCAAATTTGTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009976.2-248s1c1
Sequence:CCGGCGAGTACAACAAGGGCAGCAACTCGAGTTGCTGCCCTTGTTGTACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009976
VALIDATED
CST3 MISSION shRNA Lentiviral Transduction Particles
cystatin C
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000301320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009976.3-235s21c1
Sequence:CCGGCTTCGCTGTGAGCGAGTACAACTCGAGTTGTACTCGCTCACAGCGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009976.3-319s21c1
Sequence:CCGGCGTGGCTGGAGTGAACTATTTCTCGAGAAATAGTTCACTCCAGCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009976.3-247s21c1
Sequence:CCGGCGAGTACAACAAGGGCAGCAACTCGAGTTGCTGCCCTTGTTGTACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009976.3-418s21c1
Sequence:CCGGCCATCTGATGAGGAAGGCACTCTCGAGAGTGCCTTCCTCATCAGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009976.2-320s1c1
Sequence:CCGGCGTGGCTGGAGTGAACTATTTCTCGAGAAATAGTTCACTCCAGCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009976.2-419s1c1
Sequence:CCGGCCATCTGATGAGGAAGGCACTCTCGAGAGTGCCTTCCTCATCAGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009976.2-236s1c1
Sequence:CCGGCTTCGCTGTGAGCGAGTACAACTCGAGTTGTACTCGCTCACAGCGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009976.2-379s1c1
Sequence:CCGGCCCAGACAAATTTGACTGACTCTCGAGAGTCAGTCAAATTTGTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009976.2-248s1c1
Sequence:CCGGCGAGTACAACAAGGGCAGCAACTCGAGTTGCTGCCCTTGTTGTACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)