EMAIL THIS PAGE TO A FRIEND

CTAG1A

cancer/testis antigen 1A

18 Gene Product Result for
Synonyms: ESO1 LAGE2A
Species: Human CTAG1A(246100)
UniProtKB ID: P78358, A1L417, B7WNL9, Q7LBY4, Q9NY13
Gene ID:
Human(246100) Summary: CTAG1A is an identical copy of the CTAG1B gene (MIM 300156) (Aradhya et al., 2001 [PubMed 11709543]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_139250 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_139250 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_139250 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_139250 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139250 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00072770 predicted 248
2 SASI_Hs01_00072771 predicted 263
3 SASI_Hs01_00072772 predicted 248
4 SASI_Hs01_00072773 predicted 323
5 SASI_Hs01_00072774 predicted 302
6 SASI_Hs01_00072775 predicted 243
7 SASI_Hs01_00072776 predicted 431
8 SASI_Hs01_00072777 predicted 303
9 SASI_Hs01_00072778 predicted 426
10 SASI_Hs01_00072779 predicted 445
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139250
CTAG1A MISSION shRNA Bacterial Glycerol Stock
cancer/testis antigen 1A
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139250.1-446s21c1
Sequence:CCGGCATACTGACTATCCGACTGACCTCGAGGTCAGTCGGATAGTCAGTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139250.1-543s21c1
Sequence:CCGGCAGTGCTTTCTGCCCGTGTTTCTCGAGAAACACGGGCAGAAAGCACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139250.1-532s21c1
Sequence:CCGGTGTGGATCACGCAGTGCTTTCCTCGAGGAAAGCACTGCGTGATCCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139250.1-430s21c1
Sequence:CCGGTCACTGTGTCCGGCAACATACCTCGAGGTATGTTGCCGGACACAGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139250.1-321s21c1
Sequence:CCGGTTCTACCTCGCCATGCCTTTCCTCGAGGAAAGGCATGGCGAGGTAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180690    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139250.1-437s1c1
Sequence:CCGGGTCCGGCAACATACTGACTATCTCGAGATAGTCAGTATGTTGCCGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179000    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139250.1-443s1c1
Sequence:CCGGCAACATACTGACTATCCGACTCTCGAGAGTCGGATAGTCAGTATGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139250
CTAG1A MISSION shRNA shRNA Plasmid DNA
cancer/testis antigen 1A
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139250.1-446s21c1
Sequence:CCGGCATACTGACTATCCGACTGACCTCGAGGTCAGTCGGATAGTCAGTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139250.1-543s21c1
Sequence:CCGGCAGTGCTTTCTGCCCGTGTTTCTCGAGAAACACGGGCAGAAAGCACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139250.1-532s21c1
Sequence:CCGGTGTGGATCACGCAGTGCTTTCCTCGAGGAAAGCACTGCGTGATCCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139250.1-430s21c1
Sequence:CCGGTCACTGTGTCCGGCAACATACCTCGAGGTATGTTGCCGGACACAGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139250.1-321s21c1
Sequence:CCGGTTCTACCTCGCCATGCCTTTCCTCGAGGAAAGGCATGGCGAGGTAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180690    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139250.1-437s1c1
Sequence:CCGGGTCCGGCAACATACTGACTATCTCGAGATAGTCAGTATGTTGCCGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179000    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139250.1-443s1c1
Sequence:CCGGCAACATACTGACTATCCGACTCTCGAGAGTCGGATAGTCAGTATGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139250
CTAG1A MISSION shRNA Lentiviral Transduction Particles
cancer/testis antigen 1A
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139250.1-446s21c1
Sequence:CCGGCATACTGACTATCCGACTGACCTCGAGGTCAGTCGGATAGTCAGTATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139250.1-543s21c1
Sequence:CCGGCAGTGCTTTCTGCCCGTGTTTCTCGAGAAACACGGGCAGAAAGCACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139250.1-532s21c1
Sequence:CCGGTGTGGATCACGCAGTGCTTTCCTCGAGGAAAGCACTGCGTGATCCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139250.1-430s21c1
Sequence:CCGGTCACTGTGTCCGGCAACATACCTCGAGGTATGTTGCCGGACACAGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139250.1-321s21c1
Sequence:CCGGTTCTACCTCGCCATGCCTTTCCTCGAGGAAAGGCATGGCGAGGTAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180690    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139250.1-437s1c1
Sequence:CCGGGTCCGGCAACATACTGACTATCTCGAGATAGTCAGTATGTTGCCGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179000    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139250.1-443s1c1
Sequence:CCGGCAACATACTGACTATCCGACTCTCGAGAGTCGGATAGTCAGTATGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)