EMAIL THIS PAGE TO A FRIEND

CTBS

chitobiase, di-N-acetyl-

56 Gene Product Result for
Synonyms: CTB
UniProtKB ID: Q01459, Q5VX50
Gene ID:
Human(1486) Summary: Chitobiase is a lysosomal glycosidase involved in degradation of asparagine-linked oligosaccharides on glycoproteins (Aronson and Kuranda, 1989 [PubMed 2531691]
Mouse(74245) chitobiase, di-N-acetyl-
Rat(81652) chitobiase, di-N-acetyl-
Zebrafish(553763) chitobiase, di-N-acetyl-
dog(490188) chitobiase, di-N-acetyl-
cow(524503) chitobiase, di-N-acetyl-
chicken(424535) chitobiase, di-N-acetyl-
naked mole-rat(101718067) chitobiase, di-N-acetyl-
domestic guinea pig(100731697) chitobiase, di-N-acetyl-
sheep(101111767) chitobiase, di-N-acetyl-
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004388 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004388 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004388 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028836 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028836 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028836 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004388 Rosetta Predictions human pricing
NM_031023 Rosetta Predictions rat pricing
NM_028836 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004388 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00102918 predicted 966
2 SASI_Hs01_00102919 predicted 717
3 SASI_Hs02_00337496 predicted 716
4 SASI_Hs01_00102922 predicted 790
5 SASI_Hs01_00102923 predicted 333
6 SASI_Hs01_00102926 predicted 332
7 SASI_Hs02_00337497 predicted 964
8 SASI_Hs02_00337498 predicted 694
9 SASI_Hs01_00102917 predicted 396
10 SASI_Hs01_00102921 predicted 462
11 SASI_Hs01_00102920 predicted 618
12 SASI_Hs01_00102924 predicted 608
13 SASI_Hs01_00102925 predicted 414
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031023 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00035656 predicted 262
2 SASI_Rn02_00264220 predicted 358
3 SASI_Rn01_00035657 predicted 351
4 SASI_Rn01_00035658 predicted 371
5 SASI_Rn01_00035659 predicted 393
6 SASI_Rn01_00035661 predicted 1155
7 SASI_Rn01_00035662 predicted 1094
8 SASI_Rn01_00035663 predicted 957
9 SASI_Rn01_00035664 predicted 350
10 SASI_Rn02_00264221 predicted 711
11 SASI_Rn01_00035655 predicted 841
12 SASI_Rn01_00035660 predicted 797
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028836 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00025302 predicted 651
2 SASI_Mm01_00025303 predicted 765
3 SASI_Mm01_00025304 predicted 652
4 SASI_Mm01_00025305 predicted 804
5 SASI_Mm01_00025306 predicted 375
6 SASI_Mm01_00025307 predicted 228
7 SASI_Mm01_00025308 predicted 676
8 SASI_Mm01_00025309 predicted 385
9 SASI_Mm01_00025310 predicted 876
10 SASI_Mm02_00334469 predicted 365
11 SASI_Mm01_00025311 predicted 723
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004388
VALIDATED
CTBS MISSION shRNA Bacterial Glycerol Stock
chitobiase, di-N-acetyl-
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004388.2-335s21c1
Sequence:CCGGACTTATGTGCTACGCTCATTCCTCGAGGAATGAGCGTAGCACATAAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004388.2-218s21c1
Sequence:CCGGGATTCGCCACCATCCAGATTTCTCGAGAAATCTGGATGGTGGCGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122477    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004388.1-1332s1c1
Sequence:CCGGCCAGGAACATAAAGGCAAGAACTCGAGTTCTTGCCTTTATGTTCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004388.1-676s1c1
Sequence:CCGGCCCTATAATCAGACATTAACTCTCGAGAGTTAATGTCTGATTATAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004388.2-359s21c1
Sequence:CCGGAGGAGCCAGAGTAGTACTTAACTCGAGTTAAGTACTACTCTGGCTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004388.1-1062s1c1
Sequence:CCGGGAATGCAAACTGTCTTGACTACTCGAGTAGTCAAGACAGTTTGCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144975    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004388.1-1350s1c1
Sequence:CCGGGAAGCAAGTCAACTTACCTATCTCGAGATAGGTAAGTTGACTTGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004388.1-969s1c1
Sequence:CCGGCCACTTTCATCAAGTATGGTACTCGAGTACCATACTTGATGAAAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004388.1-934s1c1
Sequence:CCGGCGGGCTCCTTATTATAACTATCTCGAGATAGTTATAATAAGGAGCCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004388.2-529s21c1
Sequence:CCGGCATTAACTGCTTTAGTCAAAGCTCGAGCTTTGACTAAAGCAGTTAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004388.2-557s21c1
Sequence:CCGGAGACTCTTTCCATCGTGAAATCTCGAGATTTCACGATGGAAAGAGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004388.2-625s21c1
Sequence:CCGGTAGACAGAAGATGCTATAATTCTCGAGAATTATAGCATCTTCTGTCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427034    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004388.2-1263s21c1
Sequence:CCGGTGTATCAACAGATCTAGTTTCCTCGAGGAAACTAGATCTGTTGATACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004388.1-231s1c1
Sequence:CCGGGATTACAACTGTGGCAACATTCTCGAGAATGTTGCCACAGTTGTAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004388.1-706s1c1
Sequence:CCGGGACTACATCAAGATGAGCATTCTCGAGAATGCTCATCTTGATGTAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004388.1-1108s1c1
Sequence:CCGGCAAACTGAAGAAATGTGGGAACTCGAGTTCCCACATTTCTTCAGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004388
VALIDATED
CTBS MISSION shRNA shRNA Plasmid DNA
chitobiase, di-N-acetyl-
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004388.2-335s21c1
Sequence:CCGGACTTATGTGCTACGCTCATTCCTCGAGGAATGAGCGTAGCACATAAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004388.2-218s21c1
Sequence:CCGGGATTCGCCACCATCCAGATTTCTCGAGAAATCTGGATGGTGGCGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122477    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004388.1-1332s1c1
Sequence:CCGGCCAGGAACATAAAGGCAAGAACTCGAGTTCTTGCCTTTATGTTCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004388.1-676s1c1
Sequence:CCGGCCCTATAATCAGACATTAACTCTCGAGAGTTAATGTCTGATTATAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004388.2-359s21c1
Sequence:CCGGAGGAGCCAGAGTAGTACTTAACTCGAGTTAAGTACTACTCTGGCTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004388.1-1062s1c1
Sequence:CCGGGAATGCAAACTGTCTTGACTACTCGAGTAGTCAAGACAGTTTGCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144975    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004388.1-1350s1c1
Sequence:CCGGGAAGCAAGTCAACTTACCTATCTCGAGATAGGTAAGTTGACTTGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004388.1-969s1c1
Sequence:CCGGCCACTTTCATCAAGTATGGTACTCGAGTACCATACTTGATGAAAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004388.1-934s1c1
Sequence:CCGGCGGGCTCCTTATTATAACTATCTCGAGATAGTTATAATAAGGAGCCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004388.2-529s21c1
Sequence:CCGGCATTAACTGCTTTAGTCAAAGCTCGAGCTTTGACTAAAGCAGTTAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004388.2-557s21c1
Sequence:CCGGAGACTCTTTCCATCGTGAAATCTCGAGATTTCACGATGGAAAGAGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004388.2-625s21c1
Sequence:CCGGTAGACAGAAGATGCTATAATTCTCGAGAATTATAGCATCTTCTGTCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427034    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004388.2-1263s21c1
Sequence:CCGGTGTATCAACAGATCTAGTTTCCTCGAGGAAACTAGATCTGTTGATACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004388.1-231s1c1
Sequence:CCGGGATTACAACTGTGGCAACATTCTCGAGAATGTTGCCACAGTTGTAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004388.1-706s1c1
Sequence:CCGGGACTACATCAAGATGAGCATTCTCGAGAATGCTCATCTTGATGTAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004388.1-1108s1c1
Sequence:CCGGCAAACTGAAGAAATGTGGGAACTCGAGTTCCCACATTTCTTCAGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004388
VALIDATED
CTBS MISSION shRNA Lentiviral Transduction Particles
chitobiase, di-N-acetyl-
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004388.2-335s21c1
Sequence:CCGGACTTATGTGCTACGCTCATTCCTCGAGGAATGAGCGTAGCACATAAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004388.2-218s21c1
Sequence:CCGGGATTCGCCACCATCCAGATTTCTCGAGAAATCTGGATGGTGGCGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122477    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004388.1-1332s1c1
Sequence:CCGGCCAGGAACATAAAGGCAAGAACTCGAGTTCTTGCCTTTATGTTCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004388.1-676s1c1
Sequence:CCGGCCCTATAATCAGACATTAACTCTCGAGAGTTAATGTCTGATTATAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004388.2-359s21c1
Sequence:CCGGAGGAGCCAGAGTAGTACTTAACTCGAGTTAAGTACTACTCTGGCTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004388.1-1062s1c1
Sequence:CCGGGAATGCAAACTGTCTTGACTACTCGAGTAGTCAAGACAGTTTGCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144975    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004388.1-1350s1c1
Sequence:CCGGGAAGCAAGTCAACTTACCTATCTCGAGATAGGTAAGTTGACTTGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004388.1-969s1c1
Sequence:CCGGCCACTTTCATCAAGTATGGTACTCGAGTACCATACTTGATGAAAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004388.1-934s1c1
Sequence:CCGGCGGGCTCCTTATTATAACTATCTCGAGATAGTTATAATAAGGAGCCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004388.2-529s21c1
Sequence:CCGGCATTAACTGCTTTAGTCAAAGCTCGAGCTTTGACTAAAGCAGTTAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004388.2-557s21c1
Sequence:CCGGAGACTCTTTCCATCGTGAAATCTCGAGATTTCACGATGGAAAGAGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004388.2-625s21c1
Sequence:CCGGTAGACAGAAGATGCTATAATTCTCGAGAATTATAGCATCTTCTGTCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427034    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004388.2-1263s21c1
Sequence:CCGGTGTATCAACAGATCTAGTTTCCTCGAGGAAACTAGATCTGTTGATACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004388.1-231s1c1
Sequence:CCGGGATTACAACTGTGGCAACATTCTCGAGAATGTTGCCACAGTTGTAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004388.1-706s1c1
Sequence:CCGGGACTACATCAAGATGAGCATTCTCGAGAATGCTCATCTTGATGTAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004388.1-1108s1c1
Sequence:CCGGCAAACTGAAGAAATGTGGGAACTCGAGTTCCCACATTTCTTCAGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028836
CTBS MISSION shRNA Bacterial Glycerol Stock
chitobiase, di-N-acetyl-
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000415488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028836.3-726s21c1
Sequence:CCGGCTATGATTACATTTGCCTAAACTCGAGTTTAGGCAAATGTAATCATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415154    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028836.3-1047s21c1
Sequence:CCGGATGTTGCCATAACTTACTTATCTCGAGATAAGTAAGTTATGGCAACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028836.3-775s21c1
Sequence:CCGGCATCAAGTGTGGTATGATAACCTCGAGGTTATCATACCACACTTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028836.3-368s21c1
Sequence:CCGGATGGGATTAATATAGACATAGCTCGAGCTATGTCTATATTAATCCCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028836.3-602s21c1
Sequence:CCGGAGATCTGGTCAGAATGTATTGCTCGAGCAATACATTCTGACCAGATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428162    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028836.3-1137s21c1
Sequence:CCGGCTTAGATATCCAGGAATATAACTCGAGTTATATTCCTGGATATCTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028836.1-230s1c1
Sequence:CCGGGAACTTATGTGCTATGCTCATCTCGAGATGAGCATAGCACATAAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192848    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028836.1-1429s1c1
Sequence:CCGGGCCAACAAGAACTATGTGTAACTCGAGTTACACATAGTTCTTGTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028836.1-901s1c1
Sequence:CCGGCAGAGAGCAAACACAAGAAATCTCGAGATTTCTTGTGTTTGCTCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028836.1-668s1c1
Sequence:CCGGGACTACATCAAGATGGGCATTCTCGAGAATGCCCATCTTGATGTAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028836.3-176s21c1
Sequence:CCGGCTTATGACTGGTCACAGATTACTCGAGTAATCTGTGACCAGTCATAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028836
CTBS MISSION shRNA shRNA Plasmid DNA
chitobiase, di-N-acetyl-
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000415488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028836.3-726s21c1
Sequence:CCGGCTATGATTACATTTGCCTAAACTCGAGTTTAGGCAAATGTAATCATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415154    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028836.3-1047s21c1
Sequence:CCGGATGTTGCCATAACTTACTTATCTCGAGATAAGTAAGTTATGGCAACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028836.3-775s21c1
Sequence:CCGGCATCAAGTGTGGTATGATAACCTCGAGGTTATCATACCACACTTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028836.3-368s21c1
Sequence:CCGGATGGGATTAATATAGACATAGCTCGAGCTATGTCTATATTAATCCCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028836.3-602s21c1
Sequence:CCGGAGATCTGGTCAGAATGTATTGCTCGAGCAATACATTCTGACCAGATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428162    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028836.3-1137s21c1
Sequence:CCGGCTTAGATATCCAGGAATATAACTCGAGTTATATTCCTGGATATCTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028836.1-230s1c1
Sequence:CCGGGAACTTATGTGCTATGCTCATCTCGAGATGAGCATAGCACATAAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192848    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028836.1-1429s1c1
Sequence:CCGGGCCAACAAGAACTATGTGTAACTCGAGTTACACATAGTTCTTGTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028836.1-901s1c1
Sequence:CCGGCAGAGAGCAAACACAAGAAATCTCGAGATTTCTTGTGTTTGCTCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028836.1-668s1c1
Sequence:CCGGGACTACATCAAGATGGGCATTCTCGAGAATGCCCATCTTGATGTAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028836.3-176s21c1
Sequence:CCGGCTTATGACTGGTCACAGATTACTCGAGTAATCTGTGACCAGTCATAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028836
CTBS MISSION shRNA Lentiviral Transduction Particles
chitobiase, di-N-acetyl-
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000415488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028836.3-726s21c1
Sequence:CCGGCTATGATTACATTTGCCTAAACTCGAGTTTAGGCAAATGTAATCATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415154    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028836.3-1047s21c1
Sequence:CCGGATGTTGCCATAACTTACTTATCTCGAGATAAGTAAGTTATGGCAACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028836.3-775s21c1
Sequence:CCGGCATCAAGTGTGGTATGATAACCTCGAGGTTATCATACCACACTTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028836.3-368s21c1
Sequence:CCGGATGGGATTAATATAGACATAGCTCGAGCTATGTCTATATTAATCCCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028836.3-602s21c1
Sequence:CCGGAGATCTGGTCAGAATGTATTGCTCGAGCAATACATTCTGACCAGATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428162    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028836.3-1137s21c1
Sequence:CCGGCTTAGATATCCAGGAATATAACTCGAGTTATATTCCTGGATATCTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028836.1-230s1c1
Sequence:CCGGGAACTTATGTGCTATGCTCATCTCGAGATGAGCATAGCACATAAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192848    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028836.1-1429s1c1
Sequence:CCGGGCCAACAAGAACTATGTGTAACTCGAGTTACACATAGTTCTTGTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028836.1-901s1c1
Sequence:CCGGCAGAGAGCAAACACAAGAAATCTCGAGATTTCTTGTGTTTGCTCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028836.1-668s1c1
Sequence:CCGGGACTACATCAAGATGGGCATTCTCGAGAATGCCCATCTTGATGTAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028836.3-176s21c1
Sequence:CCGGCTTATGACTGGTCACAGATTACTCGAGTAATCTGTGACCAGTCATAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)