EMAIL THIS PAGE TO A FRIEND

Ctf2

36 Gene Product Result for
Gene ID:
Rat(293515) cardiotrophin 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198858 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198858 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198858 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU024111 MISSION® esiRNA targeting mouse Ctf2 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001080300 Rosetta Predictions rat pricing
XM_219355 Rosetta Predictions rat pricing
NM_198858 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080300 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00367517 predicted 621
2 SASI_Rn02_00367518 predicted 541
3 SASI_Rn02_00367519 predicted 418
4 SASI_Rn02_00367520 predicted 567
5 SASI_Rn02_00367521 predicted 525
6 SASI_Rn02_00367522 predicted 263
7 SASI_Rn02_00367523 predicted 610
8 SASI_Rn02_00367524 predicted 517
9 SASI_Rn02_00367525 predicted 631
10 SASI_Rn02_00367526 predicted 636
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_219355 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00378424 predicted 618
2 SASI_Rn02_00378425 predicted 539
3 SASI_Rn02_00378426 predicted 412
4 SASI_Rn02_00378427 predicted 567
5 SASI_Rn02_00378428 predicted 523
6 SASI_Rn02_00378429 predicted 257
7 SASI_Rn02_00378430 predicted 608
8 SASI_Rn02_00378431 predicted 511
9 SASI_Rn02_00378432 predicted 632
10 SASI_Rn02_00378433 predicted 629
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198858 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00351176 predicted 532
2 SASI_Mm01_00160607 predicted 641
3 SASI_Mm01_00160610 predicted 605
4 SASI_Mm01_00160611 predicted 556
5 SASI_Mm01_00160612 predicted 629
6 SASI_Mm01_00160614 predicted 616
7 SASI_Mm01_00160615 predicted 463
8 SASI_Mm01_00160616 predicted 384
9 SASI_Mm02_00351177 predicted 614
10 SASI_Mm02_00351178 predicted 564
11 SASI_Mm01_00160608 predicted 654
12 SASI_Mm01_00160609 predicted 663
13 SASI_Mm01_00160613 predicted 676
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198858
Ctf2 MISSION shRNA Bacterial Glycerol Stock
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000201015    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198858.1-712s1c1
Sequence:CCGGCTTCTGCATTTGGGACTATTTCTCGAGAAATAGTCCCAAATGCAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189772    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198858.1-657s1c1
Sequence:CCGGGCCTTCTATCAGAAGTCCCAACTCGAGTTGGGACTTCTGATAGAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198858.1-371s1c1
Sequence:CCGGGACGACCAGAGTTATCTGAATCTCGAGATTCAGATAACTCTGGTCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198858.1-628s1c1
Sequence:CCGGCAAGGCTAAGTACTCAGCATACTCGAGTATGCTGAGTACTTAGCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198858
Ctf2 MISSION shRNA shRNA Plasmid DNA
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000201015    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198858.1-712s1c1
Sequence:CCGGCTTCTGCATTTGGGACTATTTCTCGAGAAATAGTCCCAAATGCAGAAGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000189772    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198858.1-657s1c1
Sequence:CCGGGCCTTCTATCAGAAGTCCCAACTCGAGTTGGGACTTCTGATAGAAGGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000190485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198858.1-371s1c1
Sequence:CCGGGACGACCAGAGTTATCTGAATCTCGAGATTCAGATAACTCTGGTCGTCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000190887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198858.1-628s1c1
Sequence:CCGGCAAGGCTAAGTACTCAGCATACTCGAGTATGCTGAGTACTTAGCCTTGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198858
Ctf2 MISSION shRNA Lentiviral Transduction Particles
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000201015    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198858.1-712s1c1
Sequence:CCGGCTTCTGCATTTGGGACTATTTCTCGAGAAATAGTCCCAAATGCAGAAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189772    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198858.1-657s1c1
Sequence:CCGGGCCTTCTATCAGAAGTCCCAACTCGAGTTGGGACTTCTGATAGAAGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198858.1-371s1c1
Sequence:CCGGGACGACCAGAGTTATCTGAATCTCGAGATTCAGATAACTCTGGTCGTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198858.1-628s1c1
Sequence:CCGGCAAGGCTAAGTACTCAGCATACTCGAGTATGCTGAGTACTTAGCCTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)