EMAIL THIS PAGE TO A FRIEND

CTGF

connective tissue growth factor

111 Gene Product Result for
Synonyms: CCN2 HCS24 IGFBP8 NOV2
UniProtKB ID: P29279, E1P578, Q6LCY0, Q96A79, Q96QX2, Q9UDL6
Gene ID:
Human(1490) Summary: The protein encoded by this gene is a mitogen that is secreted by vascular endothelial cells. The encoded protein plays a role in chondrocyte proliferation and differentiation, cell adhesion in many cell types, and is related to platelet-derived growth factor. Certain polymorphisms in this gene have been linked with a higher incidence of systemic sclerosis. [provided by RefSeq, Nov 2009]
Mouse(14219) connective tissue growth factor
Rat(64032) connective tissue growth factor
chicken(374135) connective tissue growth factor
domestic cat(101094598) connective tissue growth factor
cow(281103) connective tissue growth factor
sheep(100303607) connective tissue growth factor
Domestic Rabbit(100008638) connective tissue growth factor
domestic guinea pig(100726380) connective tissue growth factor
naked mole-rat(101706835) connective tissue growth factor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
C4871 Anti-CTGF (181-195) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1300909 Anti-CTGF (C-term) antibody produced in rabbit saturated ammonium sulfate (SAS) precipitated, buffered aqueous solution human
ELISA, immunohistochemistry pricing
SAB1300910 Anti-CTGF (center) antibody produced in rabbit saturated ammonium sulfate (SAS) precipitated, buffered aqueous solution human
ELISA, immunohistochemistry pricing
HPA031074 Anti-CTGF antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, ab1 human
immunofluorescence, immunohistochemistry, western blot pricing
HPA031075 Anti-CTGF antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, ab2 human
immunofluorescence, immunohistochemistry, western blot pricing
AMAB91366 Monoclonal Anti-CTGF antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL5339, purified immunoglobulin, buffered aqueous glycerol solution human, mouse, rat
immunohistochemistry, western blot pricing
SAB4200401 Monoclonal Anti-CTGF antibody produced in mouse ~1.0 mg/mL, clone CTGF-14, purified immunoglobulin human
immunoprecipitation (IP), western blot pricing
SAB1403710 Monoclonal Anti-CTGF antibody produced in mouse clone 4D9, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1402162 Monoclonal Anti-CTGF antibody produced in mouse clone 2C11, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001901 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001901 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001901 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010217 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010217 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010217 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001901 Rosetta Predictions human pricing
NM_022266 Rosetta Predictions rat pricing
NM_010217 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001901 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087549 predicted 998
2 SASI_Hs01_00087550 predicted 1262
3 SASI_Hs01_00087551 predicted 1339
4 SASI_Hs01_00087552 predicted 1327
5 SASI_Hs01_00087553 predicted 1028
6 SASI_Hs01_00087554 predicted 1395
7 SASI_Hs01_00087555 predicted 1046
8 SASI_Hs01_00087556 predicted 1537
9 SASI_Hs01_00087557 predicted 1466
10 SASI_Hs01_00087558 predicted 1550
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022266 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00034988 predicted 1745
2 SASI_Rn01_00034990 predicted 1007
3 SASI_Rn02_00263070 predicted 1754
4 SASI_Rn02_00263071 predicted 1018
5 SASI_Rn01_00034991 predicted 977
6 SASI_Rn01_00034992 predicted 788
7 SASI_Rn01_00034993 predicted 772
8 SASI_Rn01_00034994 predicted 939
9 SASI_Rn01_00034995 predicted 1570
10 SASI_Rn01_00034996 predicted 424
11 SASI_Rn01_00034989 predicted 1638
12 SASI_Rn01_00034997 predicted 1658
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010217 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00097842 predicted 1538
2 SASI_Mm01_00097843 predicted 1527
3 SASI_Mm01_00097844 predicted 1514
4 SASI_Mm02_00318066 predicted 1311
5 SASI_Mm01_00097845 predicted 1633
6 SASI_Mm01_00097846 predicted 1692
7 SASI_Mm01_00097847 predicted 1465
8 SASI_Mm01_00097848 predicted 1472
9 SASI_Mm01_00097849 predicted 1405
10 SASI_Mm01_00097850 predicted 1364
11 SASI_Mm01_00097851 predicted 504
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001901
CTGF MISSION shRNA Bacterial Glycerol Stock
connective tissue growth factor
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001901.1-887s1c1
Sequence:CCGGGAGAACATTAAGAAGGGCAAACTCGAGTTTGCCCTTCTTAATGTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001901.1-969s1c1
Sequence:CCGGGCATGAAGACATACCGAGCTACTCGAGTAGCTCGGTATGTCTTCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001901.1-650s1c1
Sequence:CCGGCCCAAGGACCAAACCGTGGTTCTCGAGAACCACGGTTTGGTCCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001901.1-1147s1c1
Sequence:CCGGCATCTTTGAATCGCTGTACTACTCGAGTAGTACAGCGATTCAAAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001901.1-711s1c1
Sequence:CCGGGCCCAGACCCAACTATGATTACTCGAGTAATCATAGTTGGGTCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001901.2-1186s21c1
Sequence:CCGGACAACTGTCCCGGAGACAATGCTCGAGCATTGTCTCCGGGACAGTTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423874    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001901.2-1410s21c1
Sequence:CCGGATGTCAAACAAATAGTCTATCCTCGAGGATAGACTATTTGTTTGACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423324    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001901.2-1332s21c1
Sequence:CCGGATTTCAGTAGCACAAGTTATTCTCGAGAATAACTTGTGCTACTGAAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001901
CTGF MISSION shRNA shRNA Plasmid DNA
connective tissue growth factor
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001901.1-887s1c1
Sequence:CCGGGAGAACATTAAGAAGGGCAAACTCGAGTTTGCCCTTCTTAATGTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001901.1-969s1c1
Sequence:CCGGGCATGAAGACATACCGAGCTACTCGAGTAGCTCGGTATGTCTTCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001901.1-650s1c1
Sequence:CCGGCCCAAGGACCAAACCGTGGTTCTCGAGAACCACGGTTTGGTCCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001901.1-1147s1c1
Sequence:CCGGCATCTTTGAATCGCTGTACTACTCGAGTAGTACAGCGATTCAAAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001901.1-711s1c1
Sequence:CCGGGCCCAGACCCAACTATGATTACTCGAGTAATCATAGTTGGGTCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000445928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001901.2-1186s21c1
Sequence:CCGGACAACTGTCCCGGAGACAATGCTCGAGCATTGTCTCCGGGACAGTTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423874    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001901.2-1410s21c1
Sequence:CCGGATGTCAAACAAATAGTCTATCCTCGAGGATAGACTATTTGTTTGACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423324    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001901.2-1332s21c1
Sequence:CCGGATTTCAGTAGCACAAGTTATTCTCGAGAATAACTTGTGCTACTGAAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001901
CTGF MISSION shRNA Lentiviral Transduction Particles
connective tissue growth factor
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001901.1-887s1c1
Sequence:CCGGGAGAACATTAAGAAGGGCAAACTCGAGTTTGCCCTTCTTAATGTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001901.1-969s1c1
Sequence:CCGGGCATGAAGACATACCGAGCTACTCGAGTAGCTCGGTATGTCTTCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001901.1-650s1c1
Sequence:CCGGCCCAAGGACCAAACCGTGGTTCTCGAGAACCACGGTTTGGTCCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001901.1-1147s1c1
Sequence:CCGGCATCTTTGAATCGCTGTACTACTCGAGTAGTACAGCGATTCAAAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001901.1-711s1c1
Sequence:CCGGGCCCAGACCCAACTATGATTACTCGAGTAATCATAGTTGGGTCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001901.2-1186s21c1
Sequence:CCGGACAACTGTCCCGGAGACAATGCTCGAGCATTGTCTCCGGGACAGTTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423874    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001901.2-1410s21c1
Sequence:CCGGATGTCAAACAAATAGTCTATCCTCGAGGATAGACTATTTGTTTGACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423324    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001901.2-1332s21c1
Sequence:CCGGATTTCAGTAGCACAAGTTATTCTCGAGAATAACTTGTGCTACTGAAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010217
CTGF MISSION shRNA Bacterial Glycerol Stock
connective tissue growth factor
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109665    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010217.1-2079s1c1
Sequence:CCGGGCAGGTGATAAAGCTATGTATCTCGAGATACATAGCTTTATCACCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010217.1-789s1c1
Sequence:CCGGCCCAACTATGATGCGAGCCAACTCGAGTTGGCTCGCATCATAGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010217.1-1041s1c1
Sequence:CCGGTGTGAAGACATACAGGGCTAACTCGAGTTAGCCCTGTATGTCTTCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010217.1-1239s1c1
Sequence:CCGGCAGGAAGATGTACGGAGACATCTCGAGATGTCTCCGTACATCTTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010217.1-572s1c1
Sequence:CCGGGCTGCAAATACCAATGCACTTCTCGAGAAGTGCATTGGTATTTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010217.2-1106s21c1
Sequence:CCGGTGTGAAGACATACAGGGCTAACTCGAGTTAGCCCTGTATGTCTTCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010217.2-1304s21c1
Sequence:CCGGCAGGAAGATGTACGGAGACATCTCGAGATGTCTCCGTACATCTTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010217.2-854s21c1
Sequence:CCGGCCCAACTATGATGCGAGCCAACTCGAGTTGGCTCGCATCATAGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010217.2-637s21c1
Sequence:CCGGGCTGCAAATACCAATGCACTTCTCGAGAAGTGCATTGGTATTTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353796    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010217.2-2145s21c1
Sequence:CCGGGCAGGTGATAAAGCTATGTATCTCGAGATACATAGCTTTATCACCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010217
CTGF MISSION shRNA shRNA Plasmid DNA
connective tissue growth factor
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109665    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010217.1-2079s1c1
Sequence:CCGGGCAGGTGATAAAGCTATGTATCTCGAGATACATAGCTTTATCACCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010217.1-789s1c1
Sequence:CCGGCCCAACTATGATGCGAGCCAACTCGAGTTGGCTCGCATCATAGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010217.1-1041s1c1
Sequence:CCGGTGTGAAGACATACAGGGCTAACTCGAGTTAGCCCTGTATGTCTTCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010217.1-1239s1c1
Sequence:CCGGCAGGAAGATGTACGGAGACATCTCGAGATGTCTCCGTACATCTTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010217.1-572s1c1
Sequence:CCGGGCTGCAAATACCAATGCACTTCTCGAGAAGTGCATTGGTATTTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010217.2-1106s21c1
Sequence:CCGGTGTGAAGACATACAGGGCTAACTCGAGTTAGCCCTGTATGTCTTCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010217.2-1304s21c1
Sequence:CCGGCAGGAAGATGTACGGAGACATCTCGAGATGTCTCCGTACATCTTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010217.2-854s21c1
Sequence:CCGGCCCAACTATGATGCGAGCCAACTCGAGTTGGCTCGCATCATAGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010217.2-637s21c1
Sequence:CCGGGCTGCAAATACCAATGCACTTCTCGAGAAGTGCATTGGTATTTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353796    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010217.2-2145s21c1
Sequence:CCGGGCAGGTGATAAAGCTATGTATCTCGAGATACATAGCTTTATCACCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010217
CTGF MISSION shRNA Lentiviral Transduction Particles
connective tissue growth factor
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109665    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010217.1-2079s1c1
Sequence:CCGGGCAGGTGATAAAGCTATGTATCTCGAGATACATAGCTTTATCACCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010217.1-789s1c1
Sequence:CCGGCCCAACTATGATGCGAGCCAACTCGAGTTGGCTCGCATCATAGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010217.1-1041s1c1
Sequence:CCGGTGTGAAGACATACAGGGCTAACTCGAGTTAGCCCTGTATGTCTTCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010217.1-1239s1c1
Sequence:CCGGCAGGAAGATGTACGGAGACATCTCGAGATGTCTCCGTACATCTTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010217.1-572s1c1
Sequence:CCGGGCTGCAAATACCAATGCACTTCTCGAGAAGTGCATTGGTATTTGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010217.2-1106s21c1
Sequence:CCGGTGTGAAGACATACAGGGCTAACTCGAGTTAGCCCTGTATGTCTTCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010217.2-1304s21c1
Sequence:CCGGCAGGAAGATGTACGGAGACATCTCGAGATGTCTCCGTACATCTTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010217.2-854s21c1
Sequence:CCGGCCCAACTATGATGCGAGCCAACTCGAGTTGGCTCGCATCATAGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010217.2-637s21c1
Sequence:CCGGGCTGCAAATACCAATGCACTTCTCGAGAAGTGCATTGGTATTTGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353796    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010217.2-2145s21c1
Sequence:CCGGGCAGGTGATAAAGCTATGTATCTCGAGATACATAGCTTTATCACCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)