EMAIL THIS PAGE TO A FRIEND

CTXN2

cortexin 2

8 Gene Product Result for
UniProtKB ID: P0C2S0
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001145668 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001145668 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001145668 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001145668
CTXN2 MISSION shRNA Bacterial Glycerol Stock
cortexin 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371212    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145668.1-771s21c1
Sequence:CCGGTTCCTTTCTTGTGCTAATAAACTCGAGTTTATTAGCACAAGAAAGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344448    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145668.1-525s21c1
Sequence:CCGGGGACACATTCTGGATACAATTCTCGAGAATTGTATCCAGAATGTGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145668.1-423s21c1
Sequence:CCGGCCTCTACATGGGAAGATGAAGCTCGAGCTTCATCTTCCCATGTAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145668.1-483s21c1
Sequence:CCGGCGTGAGAGTTCCAGCTATATGCTCGAGCATATAGCTGGAACTCTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145668.1-277s21c1
Sequence:CCGGGATGAGTGTCAACGAAGTATCCTCGAGGATACTTCGTTGACACTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145668.1-358s21c1
Sequence:CCGGCTTCTTGGGACTTCTTATTATCTCGAGATAATAAGAAGTCCCAAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145668.1-392s21c1
Sequence:CCGGATCCTGCTAGACCCATATAGTCTCGAGACTATATGGGTCTAGCAGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001145668
CTXN2 MISSION shRNA shRNA Plasmid DNA
cortexin 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371212    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145668.1-771s21c1
Sequence:CCGGTTCCTTTCTTGTGCTAATAAACTCGAGTTTATTAGCACAAGAAAGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344448    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145668.1-525s21c1
Sequence:CCGGGGACACATTCTGGATACAATTCTCGAGAATTGTATCCAGAATGTGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145668.1-423s21c1
Sequence:CCGGCCTCTACATGGGAAGATGAAGCTCGAGCTTCATCTTCCCATGTAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145668.1-483s21c1
Sequence:CCGGCGTGAGAGTTCCAGCTATATGCTCGAGCATATAGCTGGAACTCTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145668.1-277s21c1
Sequence:CCGGGATGAGTGTCAACGAAGTATCCTCGAGGATACTTCGTTGACACTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145668.1-358s21c1
Sequence:CCGGCTTCTTGGGACTTCTTATTATCTCGAGATAATAAGAAGTCCCAAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145668.1-392s21c1
Sequence:CCGGATCCTGCTAGACCCATATAGTCTCGAGACTATATGGGTCTAGCAGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001145668
CTXN2 MISSION shRNA Lentiviral Transduction Particles
cortexin 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371212    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145668.1-771s21c1
Sequence:CCGGTTCCTTTCTTGTGCTAATAAACTCGAGTTTATTAGCACAAGAAAGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344448    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145668.1-525s21c1
Sequence:CCGGGGACACATTCTGGATACAATTCTCGAGAATTGTATCCAGAATGTGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145668.1-423s21c1
Sequence:CCGGCCTCTACATGGGAAGATGAAGCTCGAGCTTCATCTTCCCATGTAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145668.1-483s21c1
Sequence:CCGGCGTGAGAGTTCCAGCTATATGCTCGAGCATATAGCTGGAACTCTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145668.1-277s21c1
Sequence:CCGGGATGAGTGTCAACGAAGTATCCTCGAGGATACTTCGTTGACACTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145668.1-358s21c1
Sequence:CCGGCTTCTTGGGACTTCTTATTATCTCGAGATAATAAGAAGTCCCAAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145668.1-392s21c1
Sequence:CCGGATCCTGCTAGACCCATATAGTCTCGAGACTATATGGGTCTAGCAGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)