EMAIL THIS PAGE TO A FRIEND

CXCL14

chemokine (C-X-C motif) ligand 14

153 Gene Product Result for
Synonyms: BMAC BRAK KEC KS1 MIP-2g MIP2G NJAC SCYB14
UniProtKB ID: O95715, B3KQU8, Q6UW97, Q86U69, Q9BTR1, Q9NS21
Gene ID:
Human(9547) Summary: This gene belongs to the cytokine gene family which encode secreted proteins involved in immunoregulatory and inflammatory processes. The protein encoded by this gene is structurally related to the CXC (Cys-X-Cys) subfamily of cytokines. Members of this subfamily are characterized by two cysteines separated by a single amino acid. This cytokine displays chemotactic activity for monocytes but not for lymphocytes, dendritic cells, neutrophils or macrophages. It has been implicated that this cytokine is involved in the homeostasis of monocyte-derived macrophages rather than in inflammation. [provided by RefSeq, Jul 2008]
Mouse(57266) chemokine (C-X-C motif) ligand 14
Rat(306748) chemokine (C-X-C motif) ligand 14
Zebrafish(58151) chemokine (C-X-C motif) ligand 14
dog(610078) chemokine (C-X-C motif) ligand 14
domestic cat(101087962) chemokine (C-X-C motif) ligand 14
chicken(395451) chemokine (C-X-C motif) ligand 14
cow(511771) chemokine (C-X-C motif) ligand 14
domestic guinea pig(100716180) chemokine (C-X-C motif) ligand 14
naked mole-rat(101705206) chemokine (C-X-C motif) ligand 14
sheep(101105243) chemokine (C-X-C motif) ligand 14
Gene Class: Cytokines_and_Chemokines
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0647 Human CXCL14 / C-X-C Motif Chemokine 14 ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004887 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004887 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004887 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019568 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019568 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019568 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU090481 MISSION® esiRNA esiRNA targeting mouse Cxcl14 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004887 Rosetta Predictions human pricing
NM_001013137 Rosetta Predictions rat pricing
NM_019568 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004887 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196306 predicted 1126
2 SASI_Hs01_00196307 predicted 1132
3 SASI_Hs01_00196309 predicted 927
4 SASI_Hs01_00196310 predicted 928
5 SASI_Hs01_00196311 predicted 734
6 SASI_Hs01_00196314 predicted 1267
7 SASI_Hs01_00196315 predicted 994
8 SASI_Hs02_00338519 predicted 1212
9 SASI_Hs02_00338520 predicted 781
10 SASI_Hs02_00338521 predicted 1197
11 SASI_Hs01_00196308 predicted 1169
12 SASI_Hs01_00196312 predicted 1182
13 SASI_Hs01_00196313 predicted 663
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013137 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00068218 predicted 428
2 SASI_Rn01_00068219 predicted 348
3 SASI_Rn01_00068220 predicted 418
4 SASI_Rn01_00068221 predicted 448
5 SASI_Rn01_00068222 predicted 443
6 SASI_Rn01_00068223 predicted 376
7 SASI_Rn01_00068224 predicted 428
8 SASI_Rn01_00068225 predicted 367
9 SASI_Rn02_00200861 predicted 473
10 SASI_Rn01_00068217 predicted 353
11 SASI_Rn01_00068226 predicted 306
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019568 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00324622 predicted 619
2 SASI_Mm01_00036981 predicted 604
3 SASI_Mm01_00036982 predicted 628
4 SASI_Mm01_00036983 predicted 522
5 SASI_Mm01_00036984 predicted 473
6 SASI_Mm01_00036985 predicted 532
7 SASI_Mm01_00036986 predicted 613
8 SASI_Mm01_00036987 predicted 660
9 SASI_Mm01_00036988 predicted 553
10 SASI_Mm01_00036989 predicted 600
11 SASI_Mm01_00036990 predicted 428
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004887
CXCL14 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-X-C motif) ligand 14
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377839    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004887.4-1120s21c1
Sequence:CCGGATTTGTCCATACGTCACTATACTCGAGTATAGTGACGTATGGACAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004887.4-560s21c1
Sequence:CCGGTGGACGGGTCCAAATGCAAGTCTCGAGACTTGCATTTGGACCCGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372013    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004887.4-851s21c1
Sequence:CCGGCAAAGGACTTTGCAGATTAAACTCGAGTTTAATCTGCAAAGTCCTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004887.3-744s1c1
Sequence:CCGGGCGCTTCATCAAGTGGTACAACTCGAGTTGTACCACTTGATGAAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004887.3-654s1c1
Sequence:CCGGCGAGGAGAAGATGGTTATCATCTCGAGATGATAACCATCTTCTCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004887.3-600s1c1
Sequence:CCGGGATCCGCTACAGCGACGTGAACTCGAGTTCACGTCGCTGTAGCGGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004887.3-780s1c1
Sequence:CCGGGCGCAGGGTCTACGAAGAATACTCGAGTATTCTTCGTAGACCCTGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004887.3-612s1c1
Sequence:CCGGCGACGTGAAGAAGCTGGAAATCTCGAGATTTCCAGCTTCTTCACGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004887
CXCL14 MISSION shRNA shRNA Plasmid DNA
chemokine (C-X-C motif) ligand 14
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377839    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004887.4-1120s21c1
Sequence:CCGGATTTGTCCATACGTCACTATACTCGAGTATAGTGACGTATGGACAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004887.4-560s21c1
Sequence:CCGGTGGACGGGTCCAAATGCAAGTCTCGAGACTTGCATTTGGACCCGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372013    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004887.4-851s21c1
Sequence:CCGGCAAAGGACTTTGCAGATTAAACTCGAGTTTAATCTGCAAAGTCCTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004887.3-744s1c1
Sequence:CCGGGCGCTTCATCAAGTGGTACAACTCGAGTTGTACCACTTGATGAAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004887.3-654s1c1
Sequence:CCGGCGAGGAGAAGATGGTTATCATCTCGAGATGATAACCATCTTCTCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004887.3-600s1c1
Sequence:CCGGGATCCGCTACAGCGACGTGAACTCGAGTTCACGTCGCTGTAGCGGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004887.3-780s1c1
Sequence:CCGGGCGCAGGGTCTACGAAGAATACTCGAGTATTCTTCGTAGACCCTGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004887.3-612s1c1
Sequence:CCGGCGACGTGAAGAAGCTGGAAATCTCGAGATTTCCAGCTTCTTCACGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004887
CXCL14 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-X-C motif) ligand 14
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377839    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004887.4-1120s21c1
Sequence:CCGGATTTGTCCATACGTCACTATACTCGAGTATAGTGACGTATGGACAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004887.4-560s21c1
Sequence:CCGGTGGACGGGTCCAAATGCAAGTCTCGAGACTTGCATTTGGACCCGTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372013    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004887.4-851s21c1
Sequence:CCGGCAAAGGACTTTGCAGATTAAACTCGAGTTTAATCTGCAAAGTCCTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004887.3-744s1c1
Sequence:CCGGGCGCTTCATCAAGTGGTACAACTCGAGTTGTACCACTTGATGAAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004887.3-654s1c1
Sequence:CCGGCGAGGAGAAGATGGTTATCATCTCGAGATGATAACCATCTTCTCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004887.3-600s1c1
Sequence:CCGGGATCCGCTACAGCGACGTGAACTCGAGTTCACGTCGCTGTAGCGGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004887.3-780s1c1
Sequence:CCGGGCGCAGGGTCTACGAAGAATACTCGAGTATTCTTCGTAGACCCTGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004887.3-612s1c1
Sequence:CCGGCGACGTGAAGAAGCTGGAAATCTCGAGATTTCCAGCTTCTTCACGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019568
CXCL14 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-X-C motif) ligand 14
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019568.1-628s1c1
Sequence:CCGGCAAGTGGTACAATGCCTGGAACTCGAGTTCCAGGCATTGTACCACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019568.1-610s1c1
Sequence:CCGGGAGCACCAAACGCTTCATCAACTCGAGTTGATGAAGCGTTTGGTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019568.1-438s1c1
Sequence:CCGGACGGGTCCAAGTGTAAGTGTTCTCGAGAACACTTACACTTGGACCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019568.1-526s1c1
Sequence:CCGGCTGCGAGGAGAAGATGGTTATCTCGAGATAACCATCTTCTCCTCGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019568.1-499s1c1
Sequence:CCGGGCTGGAAATGAAGCCAAAGTACTCGAGTACTTTGGCTTCATTTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019568
CXCL14 MISSION shRNA shRNA Plasmid DNA
chemokine (C-X-C motif) ligand 14
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019568.1-628s1c1
Sequence:CCGGCAAGTGGTACAATGCCTGGAACTCGAGTTCCAGGCATTGTACCACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019568.1-610s1c1
Sequence:CCGGGAGCACCAAACGCTTCATCAACTCGAGTTGATGAAGCGTTTGGTGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019568.1-438s1c1
Sequence:CCGGACGGGTCCAAGTGTAAGTGTTCTCGAGAACACTTACACTTGGACCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019568.1-526s1c1
Sequence:CCGGCTGCGAGGAGAAGATGGTTATCTCGAGATAACCATCTTCTCCTCGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019568.1-499s1c1
Sequence:CCGGGCTGGAAATGAAGCCAAAGTACTCGAGTACTTTGGCTTCATTTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019568
CXCL14 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-X-C motif) ligand 14
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019568.1-628s1c1
Sequence:CCGGCAAGTGGTACAATGCCTGGAACTCGAGTTCCAGGCATTGTACCACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019568.1-610s1c1
Sequence:CCGGGAGCACCAAACGCTTCATCAACTCGAGTTGATGAAGCGTTTGGTGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019568.1-438s1c1
Sequence:CCGGACGGGTCCAAGTGTAAGTGTTCTCGAGAACACTTACACTTGGACCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019568.1-526s1c1
Sequence:CCGGCTGCGAGGAGAAGATGGTTATCTCGAGATAACCATCTTCTCCTCGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019568.1-499s1c1
Sequence:CCGGGCTGGAAATGAAGCCAAAGTACTCGAGTACTTTGGCTTCATTTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)