EMAIL THIS PAGE TO A FRIEND

CXorf61

chromosome X open reading frame 61

19 Gene Product Result for
Synonyms: CT83 KK-LC-1 KKLC1
Species: Human CXorf61(203413)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001017978 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001017978 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001017978 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU103291 MISSION® esiRNA esiRNA human CXorf61 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001017978 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017978 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00306866 predicted 302
2 SASI_Hs01_00165806 predicted 221
3 SASI_Hs01_00165807 predicted 240
4 SASI_Hs01_00165808 predicted 282
5 SASI_Hs01_00165810 predicted 204
6 SASI_Hs01_00165811 predicted 232
7 SASI_Hs02_00306867 predicted 214
8 SASI_Hs01_00165812 predicted 298
9 SASI_Hs01_00165813 predicted 225
10 SASI_Hs01_00165814 predicted 201
11 SASI_Hs01_00165809 predicted 208
12 SASI_Hs01_00165815 predicted 205
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001017978
CXorf61 MISSION shRNA Bacterial Glycerol Stock
chromosome X open reading frame 61
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000129652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017978.1-252s1c1
Sequence:CCGGCCTCTTCTTCTGGGTTAATTACTCGAGTAATTAACCCAGAAGAAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017978.1-282s1c1
Sequence:CCGGCAGACAACAATCTTGCAGTCTCTCGAGAGACTGCAAGATTGTTGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017978.1-251s1c1
Sequence:CCGGCCCTCTTCTTCTGGGTTAATTCTCGAGAATTAACCCAGAAGAAGAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017978.1-207s1c1
Sequence:CCGGCTGGCGAAATGTCATCAAATTCTCGAGAATTTGATGACATTTCGCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017978.1-165s1c1
Sequence:CCGGCCTTGATTGTCTTCTGGAAATCTCGAGATTTCCAGAAGACAATCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017978.2-299s21c1
Sequence:CCGGACGACCTCTCTCGGGATATTTCTCGAGAAATATCCCGAGAGAGGTCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017978.2-435s21c1
Sequence:CCGGTGCATCACCTCACCGGAAATCCTCGAGGATTTCCGGTGAGGTGATGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017978.2-358s21c1
Sequence:CCGGATATTGGTAAACCTCAGTATGCTCGAGCATACTGAGGTTTACCAATATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017978.2-342s21c1
Sequence:CCGGAGCCAGGCAGAAGCGAATATTCTCGAGAATATTCGCTTCTGCCTGGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017978.2-149s21c1
Sequence:CCGGGCATTCTGTGTGCCTTGATTGCTCGAGCAATCAAGGCACACAGAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001017978
CXorf61 MISSION shRNA shRNA Plasmid DNA
chromosome X open reading frame 61
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000129652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017978.1-252s1c1
Sequence:CCGGCCTCTTCTTCTGGGTTAATTACTCGAGTAATTAACCCAGAAGAAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017978.1-282s1c1
Sequence:CCGGCAGACAACAATCTTGCAGTCTCTCGAGAGACTGCAAGATTGTTGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017978.1-251s1c1
Sequence:CCGGCCCTCTTCTTCTGGGTTAATTCTCGAGAATTAACCCAGAAGAAGAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017978.1-207s1c1
Sequence:CCGGCTGGCGAAATGTCATCAAATTCTCGAGAATTTGATGACATTTCGCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017978.1-165s1c1
Sequence:CCGGCCTTGATTGTCTTCTGGAAATCTCGAGATTTCCAGAAGACAATCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000440937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017978.2-299s21c1
Sequence:CCGGACGACCTCTCTCGGGATATTTCTCGAGAAATATCCCGAGAGAGGTCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017978.2-435s21c1
Sequence:CCGGTGCATCACCTCACCGGAAATCCTCGAGGATTTCCGGTGAGGTGATGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017978.2-358s21c1
Sequence:CCGGATATTGGTAAACCTCAGTATGCTCGAGCATACTGAGGTTTACCAATATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017978.2-342s21c1
Sequence:CCGGAGCCAGGCAGAAGCGAATATTCTCGAGAATATTCGCTTCTGCCTGGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017978.2-149s21c1
Sequence:CCGGGCATTCTGTGTGCCTTGATTGCTCGAGCAATCAAGGCACACAGAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001017978
CXorf61 MISSION shRNA Lentiviral Transduction Particles
chromosome X open reading frame 61
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000129652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017978.1-252s1c1
Sequence:CCGGCCTCTTCTTCTGGGTTAATTACTCGAGTAATTAACCCAGAAGAAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017978.1-282s1c1
Sequence:CCGGCAGACAACAATCTTGCAGTCTCTCGAGAGACTGCAAGATTGTTGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017978.1-251s1c1
Sequence:CCGGCCCTCTTCTTCTGGGTTAATTCTCGAGAATTAACCCAGAAGAAGAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017978.1-207s1c1
Sequence:CCGGCTGGCGAAATGTCATCAAATTCTCGAGAATTTGATGACATTTCGCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017978.1-165s1c1
Sequence:CCGGCCTTGATTGTCTTCTGGAAATCTCGAGATTTCCAGAAGACAATCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017978.2-299s21c1
Sequence:CCGGACGACCTCTCTCGGGATATTTCTCGAGAAATATCCCGAGAGAGGTCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017978.2-435s21c1
Sequence:CCGGTGCATCACCTCACCGGAAATCCTCGAGGATTTCCGGTGAGGTGATGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017978.2-358s21c1
Sequence:CCGGATATTGGTAAACCTCAGTATGCTCGAGCATACTGAGGTTTACCAATATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017978.2-342s21c1
Sequence:CCGGAGCCAGGCAGAAGCGAATATTCTCGAGAATATTCGCTTCTGCCTGGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017978.2-149s21c1
Sequence:CCGGGCATTCTGTGTGCCTTGATTGCTCGAGCAATCAAGGCACACAGAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)