EMAIL THIS PAGE TO A FRIEND

CYB5R1

cytochrome b5 reductase 1

79 Gene Product Result for
Synonyms: B5R.1 B5R1 B5R2 NQO3A2 humb5R2
Gene ID:
Mouse(72017) cytochrome b5 reductase 1
Rat(304805) cytochrome b5 reductase 1
Zebrafish(336553) cytochrome b5 reductase 1
cow(516287) cytochrome b5 reductase 1
dog(606823) NAD(P)H:quinone oxidoreductase type 3, polypeptide A2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016243 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016243 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016243 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028057 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028057 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028057 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016243 Rosetta Predictions human pricing
NM_001013126 Rosetta Predictions rat pricing
NM_028057 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016243 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00208353 predicted 589
2 SASI_Hs01_00208354 predicted 946
3 SASI_Hs01_00208355 predicted 769
4 SASI_Hs01_00208356 predicted 723
5 SASI_Hs01_00208357 predicted 966
6 SASI_Hs01_00208358 predicted 1257
7 SASI_Hs01_00208359 predicted 1040
8 SASI_Hs01_00208360 predicted 392
9 SASI_Hs01_00208361 predicted 1379
10 SASI_Hs01_00208362 predicted 567
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013126 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00113541 predicted 364
2 SASI_Rn01_00113542 predicted 729
3 SASI_Rn01_00113543 predicted 914
4 SASI_Rn01_00113544 predicted 1129
5 SASI_Rn01_00113545 predicted 1068
6 SASI_Rn01_00113546 predicted 438
7 SASI_Rn01_00113547 predicted 374
8 SASI_Rn01_00113548 predicted 1147
9 SASI_Rn01_00113549 predicted 748
10 SASI_Rn02_00200835 predicted 1148
11 SASI_Rn01_00113550 predicted 934
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028057 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00021794 predicted 573
2 SASI_Mm01_00021795 predicted 369
3 SASI_Mm01_00021796 predicted 998
4 SASI_Mm01_00021797 predicted 694
5 SASI_Mm01_00021798 predicted 989
6 SASI_Mm01_00021799 predicted 376
7 SASI_Mm01_00021800 predicted 311
8 SASI_Mm01_00021801 predicted 442
9 SASI_Mm01_00021802 predicted 642
10 SASI_Mm01_00021803 predicted 347
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016243
VALIDATED
CYB5R1 MISSION shRNA Bacterial Glycerol Stock
cytochrome b5 reductase 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_016243.1-552s1c1
Sequence:CCGGGCGAAGAAACTGGGAATGATTCTCGAGAATCATTCCCAGTTTCTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016243.1-615s1c1
Sequence:CCGGGCCATCCTGAAAGTCCCTGAACTCGAGTTCAGGGACTTTCAGGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016243.1-519s1c1
Sequence:CCGGCCCAACAAGAAATCTCCACCACTCGAGTGGTGGAGATTTCTTGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_016243.1-342s1c1
Sequence:CCGGGATCAAGGCTATGTGGATCTTCTCGAGAAGATCCACATAGCCTTGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016243.1-728s1c1
Sequence:CCGGCAATCGCTTTAAGCTCTGGTTCTCGAGAACCAGAGCTTAAAGCGATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296753    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016243.2-1035s21c1
Sequence:CCGGTCAGTACTCAAGCACTATAAGCTCGAGCTTATAGTGCTTGAGTACTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016243.2-730s21c1
Sequence:CCGGTCATCTTGCGGGAGGACTTAGCTCGAGCTAAGTCCTCCCGCAAGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016243.2-319s21c1
Sequence:CCGGTCTACCTCTCCACCCGAATTGCTCGAGCAATTCGGGTGGAGAGGTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016243.2-934s21c1
Sequence:CCGGGCCATCCCAACTTGGACAAACCTCGAGGTTTGTCCAAGTTGGGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016243.2-387s21c1
Sequence:CCGGGATCAAGGCTATGTGGATCTTCTCGAGAAGATCCACATAGCCTTGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016243
VALIDATED
CYB5R1 MISSION shRNA shRNA Plasmid DNA
cytochrome b5 reductase 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_016243.1-552s1c1
Sequence:CCGGGCGAAGAAACTGGGAATGATTCTCGAGAATCATTCCCAGTTTCTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016243.1-615s1c1
Sequence:CCGGGCCATCCTGAAAGTCCCTGAACTCGAGTTCAGGGACTTTCAGGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016243.1-519s1c1
Sequence:CCGGCCCAACAAGAAATCTCCACCACTCGAGTGGTGGAGATTTCTTGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_016243.1-342s1c1
Sequence:CCGGGATCAAGGCTATGTGGATCTTCTCGAGAAGATCCACATAGCCTTGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016243.1-728s1c1
Sequence:CCGGCAATCGCTTTAAGCTCTGGTTCTCGAGAACCAGAGCTTAAAGCGATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296753    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016243.2-1035s21c1
Sequence:CCGGTCAGTACTCAAGCACTATAAGCTCGAGCTTATAGTGCTTGAGTACTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016243.2-730s21c1
Sequence:CCGGTCATCTTGCGGGAGGACTTAGCTCGAGCTAAGTCCTCCCGCAAGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016243.2-319s21c1
Sequence:CCGGTCTACCTCTCCACCCGAATTGCTCGAGCAATTCGGGTGGAGAGGTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016243.2-934s21c1
Sequence:CCGGGCCATCCCAACTTGGACAAACCTCGAGGTTTGTCCAAGTTGGGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016243.2-387s21c1
Sequence:CCGGGATCAAGGCTATGTGGATCTTCTCGAGAAGATCCACATAGCCTTGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016243
VALIDATED
CYB5R1 MISSION shRNA Lentiviral Transduction Particles
cytochrome b5 reductase 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_016243.1-552s1c1
Sequence:CCGGGCGAAGAAACTGGGAATGATTCTCGAGAATCATTCCCAGTTTCTTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016243.1-615s1c1
Sequence:CCGGGCCATCCTGAAAGTCCCTGAACTCGAGTTCAGGGACTTTCAGGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016243.1-519s1c1
Sequence:CCGGCCCAACAAGAAATCTCCACCACTCGAGTGGTGGAGATTTCTTGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_016243.1-342s1c1
Sequence:CCGGGATCAAGGCTATGTGGATCTTCTCGAGAAGATCCACATAGCCTTGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016243.1-728s1c1
Sequence:CCGGCAATCGCTTTAAGCTCTGGTTCTCGAGAACCAGAGCTTAAAGCGATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296753    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016243.2-1035s21c1
Sequence:CCGGTCAGTACTCAAGCACTATAAGCTCGAGCTTATAGTGCTTGAGTACTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016243.2-730s21c1
Sequence:CCGGTCATCTTGCGGGAGGACTTAGCTCGAGCTAAGTCCTCCCGCAAGATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016243.2-319s21c1
Sequence:CCGGTCTACCTCTCCACCCGAATTGCTCGAGCAATTCGGGTGGAGAGGTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016243.2-934s21c1
Sequence:CCGGGCCATCCCAACTTGGACAAACCTCGAGGTTTGTCCAAGTTGGGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016243.2-387s21c1
Sequence:CCGGGATCAAGGCTATGTGGATCTTCTCGAGAAGATCCACATAGCCTTGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028057
CYB5R1 MISSION shRNA Bacterial Glycerol Stock
cytochrome b5 reductase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028057.1-381s1c1
Sequence:CCGGGATCTTGTCATCAAGGTTTATCTCGAGATAAACCTTGATGACAAGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028057.1-639s1c1
Sequence:CCGGGCCATCTTGAAAGTCCCTGAACTCGAGTTCAGGGACTTTCAAGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028057.1-742s1c1
Sequence:CCGGCCCAGTATCCTAATCGCTTTACTCGAGTAAAGCGATTAGGATACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028057.1-576s1c1
Sequence:CCGGGCGAAGAAATTGGGAATGATTCTCGAGAATCATTCCCAATTTCTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042263    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028057.1-1265s1c1
Sequence:CCGGGCCTAGTTTCTGAGAGCATTACTCGAGTAATGCTCTCAGAAACTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028057
CYB5R1 MISSION shRNA shRNA Plasmid DNA
cytochrome b5 reductase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028057.1-381s1c1
Sequence:CCGGGATCTTGTCATCAAGGTTTATCTCGAGATAAACCTTGATGACAAGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028057.1-639s1c1
Sequence:CCGGGCCATCTTGAAAGTCCCTGAACTCGAGTTCAGGGACTTTCAAGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028057.1-742s1c1
Sequence:CCGGCCCAGTATCCTAATCGCTTTACTCGAGTAAAGCGATTAGGATACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028057.1-576s1c1
Sequence:CCGGGCGAAGAAATTGGGAATGATTCTCGAGAATCATTCCCAATTTCTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042263    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028057.1-1265s1c1
Sequence:CCGGGCCTAGTTTCTGAGAGCATTACTCGAGTAATGCTCTCAGAAACTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028057
CYB5R1 MISSION shRNA Lentiviral Transduction Particles
cytochrome b5 reductase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028057.1-381s1c1
Sequence:CCGGGATCTTGTCATCAAGGTTTATCTCGAGATAAACCTTGATGACAAGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028057.1-639s1c1
Sequence:CCGGGCCATCTTGAAAGTCCCTGAACTCGAGTTCAGGGACTTTCAAGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028057.1-742s1c1
Sequence:CCGGCCCAGTATCCTAATCGCTTTACTCGAGTAAAGCGATTAGGATACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028057.1-576s1c1
Sequence:CCGGGCGAAGAAATTGGGAATGATTCTCGAGAATCATTCCCAATTTCTTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042263    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028057.1-1265s1c1
Sequence:CCGGGCCTAGTTTCTGAGAGCATTACTCGAGTAATGCTCTCAGAAACTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)