EMAIL THIS PAGE TO A FRIEND

CYCS

cytochrome c, somatic

91 Gene Product Result for
Synonyms: CYC HCS THC4
Gene ID:
Human(54205) Summary: This gene encodes a small heme protein that functions as a central component of the electron transport chain in mitochondria. The encoded protein associates with the inner membrane of the mitochondrion where it accepts electrons from cytochrome b and transfers them to the cytochrome oxidase complex. This protein is also involved in initiation of apoptosis. Mutations in this gene are associated with autosomal dominant nonsyndromic thrombocytopenia. Numerous processed pseudogenes of this gene are found throughout the human genome.[provided by RefSeq, Jul 2010]
Mouse(13063) cytochrome c, somatic
Rat(25309) cytochrome c, somatic
chicken(420624) cytochrome c, somatic
cow(510767) cytochrome c, somatic
Horse(100053958) cytochrome c, somatic
dog(475258) cytochrome c, somatic
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1410987 Anti-CYCS antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, proximity ligation assay, western blot pricing
GW20076F Anti-Cytochrome c antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
western blot pricing
C5723 Anti-Cytochrome c antibody produced in sheep whole antiserum rat, human, rabbit, canine
immunofluorescence, immunoprecipitation (IP), western blot pricing
C9616 Anti-Cytochrome c antibody produced in sheep ~0.5 mg/mL, affinity isolated antibody, buffered aqueous solution canine, human, rat, rabbit
immunofluorescence, immunohistochemistry, western blot pricing
SAB4502234 Anti-Cytochrome c, N-Terminal antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018947 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018947 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018947 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007808 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007808 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007808 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018947 Rosetta Predictions human pricing
NM_012839 Rosetta Predictions rat pricing
NM_007808 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018947 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190692 predicted 283
2 SASI_Hs01_00190690 predicted 840
3 SASI_Hs02_00352412 predicted 276
4 SASI_Hs01_00190693 predicted 290
5 SASI_Hs01_00190694 predicted 804
6 SASI_Hs01_00190687 predicted 699
7 SASI_Hs01_00190695 predicted 714
8 SASI_Hs01_00190688 predicted 904
9 SASI_Hs01_00190689 predicted 860
10 SASI_Hs02_00352413 predicted 949
11 SASI_Hs01_00190691 predicted 934
12 SASI_Hs01_00190696 predicted 956
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012839 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00081002 predicted 259
2 SASI_Rn01_00081003 predicted 618
3 SASI_Rn01_00081004 predicted 348
4 SASI_Rn01_00081005 predicted 699
5 SASI_Rn01_00081006 predicted 764
6 SASI_Rn01_00081007 predicted 454
7 SASI_Rn01_00081008 predicted 816
8 SASI_Rn01_00081009 predicted 466
9 SASI_Rn01_00081010 predicted 658
10 SASI_Rn01_00081011 predicted 208
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007808 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00312515 predicted 603
2 SASI_Mm02_00312516 predicted 605
3 SASI_Mm02_00312517 predicted 818
4 SASI_Mm02_00312518 predicted 371
5 SASI_Mm02_00312519 predicted 379
6 SASI_Mm02_00312520 predicted 756
7 SASI_Mm02_00312521 predicted 745
8 SASI_Mm02_00312522 predicted 742
9 SASI_Mm02_00312523 predicted 692
10 SASI_Mm02_00312524 predicted 521
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018947
VALIDATED
CYCS MISSION shRNA Bacterial Glycerol Stock
cytochrome c, somatic
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000344848    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018947.4-707s21c1
Sequence:CCGGTGATTAGACTTCGTTAGTAATCTCGAGATTACTAACGAAGTCTAATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018947.4-236s21c1
Sequence:CCGGCCAAATCTCCATGGTCTCTTTCTCGAGAAAGAGACCATGGAGATTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018947.4-419s21c1
Sequence:CCGGAGGGCAGACTTAATAGCTTATCTCGAGATAAGCTATTAAGTCTGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018947.4-360s21c1
Sequence:CCGGCCAAGAAGTACATCCCTGGAACTCGAGTTCCAGGGATGTACTTCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018947.4-285s21c1
Sequence:CCGGACTCTTACACAGCCGCCAATACTCGAGTATTGGCGGCTGTGTAAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018947.4-399s1c1
Sequence:CCGGGCATTAAGAAGAAGGAAGAAACTCGAGTTTCTTCCTTCTTCTTAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018947.4-236s1c1
Sequence:CCGGCCAAATCTCCATGGTCTCTTTCTCGAGAAAGAGACCATGGAGATTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018947.4-301s1c1
Sequence:CCGGCAATAAGAACAAAGGCATCATCTCGAGATGATGCCTTTGTTCTTATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018947.4-419s1c1
Sequence:CCGGAGGGCAGACTTAATAGCTTATCTCGAGATAAGCTATTAAGTCTGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018947.4-360s1c1
Sequence:CCGGCCAAGAAGTACATCCCTGGAACTCGAGTTCCAGGGATGTACTTCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018947
VALIDATED
CYCS MISSION shRNA shRNA Plasmid DNA
cytochrome c, somatic
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000344848    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018947.4-707s21c1
Sequence:CCGGTGATTAGACTTCGTTAGTAATCTCGAGATTACTAACGAAGTCTAATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018947.4-236s21c1
Sequence:CCGGCCAAATCTCCATGGTCTCTTTCTCGAGAAAGAGACCATGGAGATTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018947.4-419s21c1
Sequence:CCGGAGGGCAGACTTAATAGCTTATCTCGAGATAAGCTATTAAGTCTGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018947.4-360s21c1
Sequence:CCGGCCAAGAAGTACATCCCTGGAACTCGAGTTCCAGGGATGTACTTCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018947.4-285s21c1
Sequence:CCGGACTCTTACACAGCCGCCAATACTCGAGTATTGGCGGCTGTGTAAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018947.4-399s1c1
Sequence:CCGGGCATTAAGAAGAAGGAAGAAACTCGAGTTTCTTCCTTCTTCTTAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018947.4-236s1c1
Sequence:CCGGCCAAATCTCCATGGTCTCTTTCTCGAGAAAGAGACCATGGAGATTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018947.4-301s1c1
Sequence:CCGGCAATAAGAACAAAGGCATCATCTCGAGATGATGCCTTTGTTCTTATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018947.4-419s1c1
Sequence:CCGGAGGGCAGACTTAATAGCTTATCTCGAGATAAGCTATTAAGTCTGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018947.4-360s1c1
Sequence:CCGGCCAAGAAGTACATCCCTGGAACTCGAGTTCCAGGGATGTACTTCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018947
VALIDATED
CYCS MISSION shRNA Lentiviral Transduction Particles
cytochrome c, somatic
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000344848    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018947.4-707s21c1
Sequence:CCGGTGATTAGACTTCGTTAGTAATCTCGAGATTACTAACGAAGTCTAATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018947.4-236s21c1
Sequence:CCGGCCAAATCTCCATGGTCTCTTTCTCGAGAAAGAGACCATGGAGATTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018947.4-419s21c1
Sequence:CCGGAGGGCAGACTTAATAGCTTATCTCGAGATAAGCTATTAAGTCTGCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018947.4-360s21c1
Sequence:CCGGCCAAGAAGTACATCCCTGGAACTCGAGTTCCAGGGATGTACTTCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018947.4-285s21c1
Sequence:CCGGACTCTTACACAGCCGCCAATACTCGAGTATTGGCGGCTGTGTAAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018947.4-399s1c1
Sequence:CCGGGCATTAAGAAGAAGGAAGAAACTCGAGTTTCTTCCTTCTTCTTAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018947.4-236s1c1
Sequence:CCGGCCAAATCTCCATGGTCTCTTTCTCGAGAAAGAGACCATGGAGATTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018947.4-301s1c1
Sequence:CCGGCAATAAGAACAAAGGCATCATCTCGAGATGATGCCTTTGTTCTTATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018947.4-419s1c1
Sequence:CCGGAGGGCAGACTTAATAGCTTATCTCGAGATAAGCTATTAAGTCTGCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018947.4-360s1c1
Sequence:CCGGCCAAGAAGTACATCCCTGGAACTCGAGTTCCAGGGATGTACTTCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007808
CYCS MISSION shRNA Bacterial Glycerol Stock
cytochrome c, somatic
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119852    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007808.2-588s1c1
Sequence:CCGGGCTCTCCCTTTCTCAAGATAACTCGAGTTATCTTGAGAAAGGGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007808.2-207s1c1
Sequence:CCGGATTCTCTTACACAGATGCCAACTCGAGTTGGCATCTGTGTAAGAGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007808.2-319s1c1
Sequence:CCGGGCTGGAATTAAGAAGAAGGGACTCGAGTCCCTTCTTCTTAATTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007808.2-346s1c1
Sequence:CCGGGCAGACCTAATAGCTTATCTTCTCGAGAAGATAAGCTATTAGGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007808.2-144s1c1
Sequence:CCGGCAAGCATAAGACTGGACCAAACTCGAGTTTGGTCCAGTCTTATGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007808
CYCS MISSION shRNA shRNA Plasmid DNA
cytochrome c, somatic
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119852    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007808.2-588s1c1
Sequence:CCGGGCTCTCCCTTTCTCAAGATAACTCGAGTTATCTTGAGAAAGGGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007808.2-207s1c1
Sequence:CCGGATTCTCTTACACAGATGCCAACTCGAGTTGGCATCTGTGTAAGAGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007808.2-319s1c1
Sequence:CCGGGCTGGAATTAAGAAGAAGGGACTCGAGTCCCTTCTTCTTAATTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007808.2-346s1c1
Sequence:CCGGGCAGACCTAATAGCTTATCTTCTCGAGAAGATAAGCTATTAGGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007808.2-144s1c1
Sequence:CCGGCAAGCATAAGACTGGACCAAACTCGAGTTTGGTCCAGTCTTATGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007808
CYCS MISSION shRNA Lentiviral Transduction Particles
cytochrome c, somatic
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119852    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007808.2-588s1c1
Sequence:CCGGGCTCTCCCTTTCTCAAGATAACTCGAGTTATCTTGAGAAAGGGAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007808.2-207s1c1
Sequence:CCGGATTCTCTTACACAGATGCCAACTCGAGTTGGCATCTGTGTAAGAGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007808.2-319s1c1
Sequence:CCGGGCTGGAATTAAGAAGAAGGGACTCGAGTCCCTTCTTCTTAATTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007808.2-346s1c1
Sequence:CCGGGCAGACCTAATAGCTTATCTTCTCGAGAAGATAAGCTATTAGGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007808.2-144s1c1
Sequence:CCGGCAAGCATAAGACTGGACCAAACTCGAGTTTGGTCCAGTCTTATGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)