EMAIL THIS PAGE TO A FRIEND

CYP11B1

cytochrome P450, family 11, subfamily B, polypeptide 1

166 Gene Product Result for
Synonyms: CPN1 CYP11B FHI P450C11
UniProtKB ID: P15538, Q14095, Q4VAQ8, Q4VAQ9, Q9UML2
Gene ID:
Human(1584) Summary: This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the mitochondrial inner membrane and is involved in the conversion of progesterone to cortisol in the adrenal cortex. Mutations in this gene cause congenital adrenal hyperplasia due to 11-beta-hydroxylase deficiency. Transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Jul 2008]
Mouse(110115) cytochrome P450, family 11, subfamily b, polypeptide 1
Rat(500892) cytochrome P450, family 11, subfamily b, polypeptide 1
domestic guinea pig(100135511) cytochrome P450, family 11, subfamily b, polypeptide 1
sheep(767576) cytochrome P450, family 11, subfamily B, polypeptide 1
cow(282422) cytochrome P450, subfamily XI B, polypeptide 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
K1003 Ketoconazole ≥98% (HPLC) human, mouse, rat pricing
UC280 Ketoconazole human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000497 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000497 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000497 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033229 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033229 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033229 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU140441 MISSION® esiRNA esiRNA human CYP11B1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000497 Rosetta Predictions human pricing
NM_001026213 Rosetta Predictions human pricing
NM_012537 Rosetta Predictions rat pricing
XM_343262 Rosetta Predictions rat pricing
NM_001033229 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000497 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109365 predicted 958
2 SASI_Hs01_00109366 predicted 434
3 SASI_Hs01_00109367 predicted 1761
4 SASI_Hs01_00109368 predicted 1215
5 SASI_Hs01_00109370 predicted 97
6 SASI_Hs01_00109371 predicted 1202
7 SASI_Hs01_00109369 predicted 1491
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001026213 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049379 predicted 961
2 SASI_Hs01_00049380 predicted 429
3 SASI_Hs01_00049381 predicted 1570
4 SASI_Hs01_00049383 predicted 99
5 SASI_Hs01_00049382 predicted 1291
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012537 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00070006 predicted 552
2 SASI_Rn01_00070009 predicted 1417
3 SASI_Rn01_00070011 predicted 1192
4 SASI_Rn01_00070012 predicted 1124
5 SASI_Rn02_00259613 predicted 1135
6 SASI_Rn01_00070003 predicted 923
7 SASI_Rn01_00070004 predicted 540
8 SASI_Rn01_00070005 predicted 777
9 SASI_Rn01_00070007 predicted 875
10 SASI_Rn01_00070008 predicted 920
11 SASI_Rn01_00070010 predicted 707
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343262 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00127744 predicted 728
2 SASI_Rn01_00127745 predicted 764
3 SASI_Rn01_00127746 predicted 785
4 SASI_Rn01_00127747 predicted 784
5 SASI_Rn01_00127748 predicted 748
6 SASI_Rn01_00127749 predicted 672
7 SASI_Rn01_00127750 predicted 680
8 SASI_Rn01_00127751 predicted 719
9 SASI_Rn01_00127752 predicted 781
10 SASI_Rn01_00127753 predicted 655
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033229 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00022725 predicted 440
2 SASI_Mm01_00022726 predicted 1505
3 SASI_Mm01_00022727 predicted 784
4 SASI_Mm01_00022728 predicted 924
5 SASI_Mm01_00022729 predicted 595
6 SASI_Mm01_00022730 predicted 1484
7 SASI_Mm01_00022731 predicted 350
8 SASI_Mm01_00022732 predicted 444
9 SASI_Mm02_00288357 predicted 579
10 SASI_Mm01_00022733 predicted 637
11 SASI_Mm01_00022734 predicted 812
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000497
CYP11B1 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 11, subfamily B, polypeptide 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000425078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000497.3-901s21c1
Sequence:CCGGACTGTCGCCAGATGCCATCAACTCGAGTTGATGGCATCTGGCGACAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424572    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000497.3-1917s21c1
Sequence:CCGGTGCGCAGACTGTCAGAGTCATCTCGAGATGACTCTGACAGTCTGCGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000497.2-853s1c1
Sequence:CCGGCCCTCAACAGTACACCAGCATCTCGAGATGCTGGTGTACTGTTGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000497.2-1465s1c1
Sequence:CCGGCTTCATATTGAGGCCCAGCATCTCGAGATGCTGGGCCTCAATATGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000497.2-1498s1c1
Sequence:CCGGCACCTTCAGAGCCATCAACTACTCGAGTAGTTGATGGCTCTGAAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000497.2-202s1c1
Sequence:CCGGCCTGGAAGTACACCAGACCTTCTCGAGAAGGTCTGGTGTACTTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000497.2-1204s1c1
Sequence:CCGGTGGGACATTGGTGCGCGTGTTCTCGAGAACACGCGCACCAATGTCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000497
CYP11B1 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 11, subfamily B, polypeptide 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000425078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000497.3-901s21c1
Sequence:CCGGACTGTCGCCAGATGCCATCAACTCGAGTTGATGGCATCTGGCGACAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424572    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000497.3-1917s21c1
Sequence:CCGGTGCGCAGACTGTCAGAGTCATCTCGAGATGACTCTGACAGTCTGCGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000497.2-853s1c1
Sequence:CCGGCCCTCAACAGTACACCAGCATCTCGAGATGCTGGTGTACTGTTGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000497.2-1465s1c1
Sequence:CCGGCTTCATATTGAGGCCCAGCATCTCGAGATGCTGGGCCTCAATATGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000497.2-1498s1c1
Sequence:CCGGCACCTTCAGAGCCATCAACTACTCGAGTAGTTGATGGCTCTGAAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000497.2-202s1c1
Sequence:CCGGCCTGGAAGTACACCAGACCTTCTCGAGAAGGTCTGGTGTACTTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000497.2-1204s1c1
Sequence:CCGGTGGGACATTGGTGCGCGTGTTCTCGAGAACACGCGCACCAATGTCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000497
CYP11B1 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 11, subfamily B, polypeptide 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000425078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000497.3-901s21c1
Sequence:CCGGACTGTCGCCAGATGCCATCAACTCGAGTTGATGGCATCTGGCGACAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424572    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000497.3-1917s21c1
Sequence:CCGGTGCGCAGACTGTCAGAGTCATCTCGAGATGACTCTGACAGTCTGCGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000497.2-853s1c1
Sequence:CCGGCCCTCAACAGTACACCAGCATCTCGAGATGCTGGTGTACTGTTGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000497.2-1465s1c1
Sequence:CCGGCTTCATATTGAGGCCCAGCATCTCGAGATGCTGGGCCTCAATATGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000497.2-1498s1c1
Sequence:CCGGCACCTTCAGAGCCATCAACTACTCGAGTAGTTGATGGCTCTGAAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000497.2-202s1c1
Sequence:CCGGCCTGGAAGTACACCAGACCTTCTCGAGAAGGTCTGGTGTACTTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000497.2-1204s1c1
Sequence:CCGGTGGGACATTGGTGCGCGTGTTCTCGAGAACACGCGCACCAATGTCCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033229
CYP11B1 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 11, subfamily B, polypeptide 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000255240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033229.2-917s21c1
Sequence:CCGGGCCATCCAGGCTAACTCAATGCTCGAGCATTGAGTTAGCCTGGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033229.2-1389s21c1
Sequence:CCGGTGCTTCACCATGTGCTGAAATCTCGAGATTTCAGCACATGGTGAAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033229.2-1215s21c1
Sequence:CCGGTCCTCAATGTGAATCTGTATTCTCGAGAATACAGATTCACATTGAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255239    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033229.2-2068s21c1
Sequence:CCGGTGTAGACTTGTGGTAACATATCTCGAGATATGTTACCACAAGTCTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033229.2-579s21c1
Sequence:CCGGAGTCCAGTGTGTTCAACTATACTCGAGTATAGTTGAACACACTGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033229
CYP11B1 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 11, subfamily B, polypeptide 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000255240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033229.2-917s21c1
Sequence:CCGGGCCATCCAGGCTAACTCAATGCTCGAGCATTGAGTTAGCCTGGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033229.2-1389s21c1
Sequence:CCGGTGCTTCACCATGTGCTGAAATCTCGAGATTTCAGCACATGGTGAAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033229.2-1215s21c1
Sequence:CCGGTCCTCAATGTGAATCTGTATTCTCGAGAATACAGATTCACATTGAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255239    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033229.2-2068s21c1
Sequence:CCGGTGTAGACTTGTGGTAACATATCTCGAGATATGTTACCACAAGTCTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033229.2-579s21c1
Sequence:CCGGAGTCCAGTGTGTTCAACTATACTCGAGTATAGTTGAACACACTGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033229
CYP11B1 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 11, subfamily B, polypeptide 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000255240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033229.2-917s21c1
Sequence:CCGGGCCATCCAGGCTAACTCAATGCTCGAGCATTGAGTTAGCCTGGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033229.2-1389s21c1
Sequence:CCGGTGCTTCACCATGTGCTGAAATCTCGAGATTTCAGCACATGGTGAAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033229.2-1215s21c1
Sequence:CCGGTCCTCAATGTGAATCTGTATTCTCGAGAATACAGATTCACATTGAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255239    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033229.2-2068s21c1
Sequence:CCGGTGTAGACTTGTGGTAACATATCTCGAGATATGTTACCACAAGTCTACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033229.2-579s21c1
Sequence:CCGGAGTCCAGTGTGTTCAACTATACTCGAGTATAGTTGAACACACTGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)