EMAIL THIS PAGE TO A FRIEND

CYP21A2

cytochrome P450, family 21, subfamily A, polypeptide 2

64 Gene Product Result for
Synonyms: CA21H CAH1 CPS1 CYP21 CYP21B P450c21B
Gene ID:
Human(1589) Summary: This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and hydroxylates steroids at the 21 position. Its activity is required for the synthesis of steroid hormones including cortisol and aldosterone. Mutations in this gene cause congenital adrenal hyperplasia. A related pseudogene is located near this gene; gene conversion events involving the functional gene and the pseudogene are thought to account for many cases of steroid 21-hydroxylase deficiency. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
chicken(429828) cytochrome P450, family 21, subfamily A, polypeptide 2
cow(282425) cytochrome P450, family 21, subfamily A, polypeptide 2
dog(415124) cytochrome P450c21
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000500 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000500 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000500 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000500 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000500 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065775 predicted 660
2 SASI_Hs01_00065776 predicted 698
3 SASI_Hs01_00065777 predicted 433
4 SASI_Hs01_00065778 predicted 1181
5 SASI_Hs01_00065780 predicted 1009
6 SASI_Hs01_00065781 predicted 1258
7 SASI_Hs01_00065782 predicted 667
8 SASI_Hs01_00065784 predicted 401
9 SASI_Hs02_00302667 predicted 642
10 SASI_Hs02_00302668 predicted 433
11 SASI_Hs01_00065779 predicted 389
12 SASI_Hs01_00065783 predicted 682
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000500
CYP21A2 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 21, subfamily A, polypeptide 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000500.4-1645s1c1
Sequence:CCGGCCTTTATTGCTCCTGTACGAACTCGAGTTCGTACAGGAGCAATAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000500.4-808s1c1
Sequence:CCGGCATAGAGAAGAGGGATCACATCTCGAGATGTGATCCCTCTTCTCTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000500.4-265s1c1
Sequence:CCGGGCTTGGCCTGACTCAGAAATTCTCGAGAATTTCTGAGTCAGGCCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000500.4-682s1c1
Sequence:CCGGGCCTGCCTATTACAAATGTATCTCGAGATACATTTGTAATAGGCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000500.4-670s1c1
Sequence:CCGGCGACAACTTAATGCCTGCCTACTCGAGTAGGCAGGCATTAAGTTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000500
CYP21A2 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 21, subfamily A, polypeptide 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000500.4-1645s1c1
Sequence:CCGGCCTTTATTGCTCCTGTACGAACTCGAGTTCGTACAGGAGCAATAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000500.4-808s1c1
Sequence:CCGGCATAGAGAAGAGGGATCACATCTCGAGATGTGATCCCTCTTCTCTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000500.4-265s1c1
Sequence:CCGGGCTTGGCCTGACTCAGAAATTCTCGAGAATTTCTGAGTCAGGCCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000500.4-682s1c1
Sequence:CCGGGCCTGCCTATTACAAATGTATCTCGAGATACATTTGTAATAGGCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000500.4-670s1c1
Sequence:CCGGCGACAACTTAATGCCTGCCTACTCGAGTAGGCAGGCATTAAGTTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000500
CYP21A2 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 21, subfamily A, polypeptide 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000500.4-1645s1c1
Sequence:CCGGCCTTTATTGCTCCTGTACGAACTCGAGTTCGTACAGGAGCAATAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000500.4-808s1c1
Sequence:CCGGCATAGAGAAGAGGGATCACATCTCGAGATGTGATCCCTCTTCTCTATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000500.4-265s1c1
Sequence:CCGGGCTTGGCCTGACTCAGAAATTCTCGAGAATTTCTGAGTCAGGCCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000500.4-682s1c1
Sequence:CCGGGCCTGCCTATTACAAATGTATCTCGAGATACATTTGTAATAGGCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000500.4-670s1c1
Sequence:CCGGCGACAACTTAATGCCTGCCTACTCGAGTAGGCAGGCATTAAGTTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)