EMAIL THIS PAGE TO A FRIEND

Cyp2a5

32 Gene Product Result for
Species: Mouse Cyp2a5(13087)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0032 AQUA Peptide VHEEID[R] African clawed frog, cow, dog, human, mouse, pig, rat pricing
AQ0102 AQUA Peptide DFIDSFLI[R] cow, dog, human, mouse, pig, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007812 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007812 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007812 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU093751 MISSION® esiRNA esiRNA targeting mouse Cyp2a5 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007812 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007812 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00172529 predicted 400
2 SASI_Mm02_00312528 predicted 687
3 SASI_Mm02_00312529 predicted 767
4 SASI_Mm02_00312530 predicted 1390
5 SASI_Mm01_00172530 predicted 485
6 SASI_Mm02_00312531 predicted 898
7 SASI_Mm01_00172531 predicted 588
8 SASI_Mm01_00172532 predicted 1331
9 SASI_Mm01_00172533 predicted 211
10 SASI_Mm02_00312532 predicted 1377
11 SASI_Mm01_00172534 predicted 156
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007812
Cyp2a5 MISSION shRNA Bacterial Glycerol Stock
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000174715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007812.1-882s1c1
Sequence:CCGGGACTACACTAAATCTCTTCTTCTCGAGAAGAAGAGATTTAGTGTAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007812.1-1080s1c1
Sequence:CCGGCCAGAGATTTGCAGACATGATCTCGAGATCATGTCTGCAAATCTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007812.1-159s1c1
Sequence:CCGGGCAAATGTACAACTCTCTCATCTCGAGATGAGAGAGTTGTACATTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007812.1-529s1c1
Sequence:CCGGCGAACAGTCTCCAATGTCATTCTCGAGAATGACATTGGAGACTGTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007812.1-1362s1c1
Sequence:CCGGCACAAACATCATGCAGAACTTCTCGAGAAGTTCTGCATGATGTTTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007812
Cyp2a5 MISSION shRNA shRNA Plasmid DNA
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000174715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007812.1-882s1c1
Sequence:CCGGGACTACACTAAATCTCTTCTTCTCGAGAAGAAGAGATTTAGTGTAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007812.1-1080s1c1
Sequence:CCGGCCAGAGATTTGCAGACATGATCTCGAGATCATGTCTGCAAATCTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007812.1-159s1c1
Sequence:CCGGGCAAATGTACAACTCTCTCATCTCGAGATGAGAGAGTTGTACATTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007812.1-529s1c1
Sequence:CCGGCGAACAGTCTCCAATGTCATTCTCGAGAATGACATTGGAGACTGTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007812.1-1362s1c1
Sequence:CCGGCACAAACATCATGCAGAACTTCTCGAGAAGTTCTGCATGATGTTTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007812
Cyp2a5 MISSION shRNA Lentiviral Transduction Particles
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000174715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007812.1-882s1c1
Sequence:CCGGGACTACACTAAATCTCTTCTTCTCGAGAAGAAGAGATTTAGTGTAGTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007812.1-1080s1c1
Sequence:CCGGCCAGAGATTTGCAGACATGATCTCGAGATCATGTCTGCAAATCTCTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007812.1-159s1c1
Sequence:CCGGGCAAATGTACAACTCTCTCATCTCGAGATGAGAGAGTTGTACATTTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007812.1-529s1c1
Sequence:CCGGCGAACAGTCTCCAATGTCATTCTCGAGAATGACATTGGAGACTGTTCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007812.1-1362s1c1
Sequence:CCGGCACAAACATCATGCAGAACTTCTCGAGAAGTTCTGCATGATGTTTGTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)