EMAIL THIS PAGE TO A FRIEND

CYP2A6

cytochrome P450, family 2, subfamily A, polypeptide 6

40 Gene Product Result for
Synonyms: CPA6 CYP2A CYP2A3 CYPIIA6 P450C2A P450PB
Gene ID:
Human(1548) Summary: This gene, CYP2A6, encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and its expression is induced by phenobarbital. The enzyme is known to hydroxylate coumarin, and also metabolizes nicotine, aflatoxin B1, nitrosamines, and some pharmaceuticals. Individuals with certain allelic variants are said to have a poor metabolizer phenotype, meaning they do not efficiently metabolize coumarin or nicotine. This gene is part of a large cluster of cytochrome P450 genes from the CYP2A, CYP2B and CYP2F subfamilies on chromosome 19q. The gene was formerly referred to as CYP2A3; however, it has been renamed CYP2A6. [provided by RefSeq, Jul 2008]
sheep(100568289) cytochrome P450 2A6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0032 AQUA Peptide VHEEID[R] African clawed frog, cow, dog, human, mouse, pig, rat pricing
AQ0102 AQUA Peptide DFIDSFLI[R] cow, dog, human, mouse, pig, rat pricing
AQ0033 AQUA Peptide HVGFATIP[R] dog, human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000762 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000762 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000762 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000762 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000762 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080114 predicted 1108 140.00
2 SASI_Hs01_00080115 predicted 876 140.00
3 SASI_Hs01_00080116 predicted 1245 140.00
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000762
CYP2A6 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 2, subfamily A, polypeptide 6
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000762.4-802s1c1
Sequence:CCGGCGGGACTTCATTGACTCCTTTCTCGAGAAAGGAGTCAATGAAGTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000762.4-51s1c1
Sequence:CCGGCCTGACTGTAATGGTCTTGATCTCGAGATCAAGACCATTACAGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000762.4-1086s1c1
Sequence:CCGGCCAAAGATTTGGAGACGTGATCTCGAGATCACGTCTCCAAATCTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000762.4-342s1c1
Sequence:CCGGCAAAGGCTATGGCGTGGTATTCTCGAGAATACCACGCCATAGCCTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000762.4-577s1c1
Sequence:CCGGCGCTTTGACTATAAGGACAAACTCGAGTTTGTCCTTATAGTCAAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000762.5-1321s21c1
Sequence:CCGGATCGGAAAGCGGAACTGTTTCCTCGAGGAAACAGTTCCGCTTTCCGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000762.5-686s21c1
Sequence:CCGCTGTTCTCTTCGGTGATGAAACCTCGAGGTTTCATCACCGAAGAGAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000762
CYP2A6 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 2, subfamily A, polypeptide 6
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000762.4-802s1c1
Sequence:CCGGCGGGACTTCATTGACTCCTTTCTCGAGAAAGGAGTCAATGAAGTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000762.4-51s1c1
Sequence:CCGGCCTGACTGTAATGGTCTTGATCTCGAGATCAAGACCATTACAGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000762.4-1086s1c1
Sequence:CCGGCCAAAGATTTGGAGACGTGATCTCGAGATCACGTCTCCAAATCTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000762.4-342s1c1
Sequence:CCGGCAAAGGCTATGGCGTGGTATTCTCGAGAATACCACGCCATAGCCTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000762.4-577s1c1
Sequence:CCGGCGCTTTGACTATAAGGACAAACTCGAGTTTGTCCTTATAGTCAAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000762.5-1321s21c1
Sequence:CCGGATCGGAAAGCGGAACTGTTTCCTCGAGGAAACAGTTCCGCTTTCCGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000762.5-686s21c1
Sequence:CCGCTGTTCTCTTCGGTGATGAAACCTCGAGGTTTCATCACCGAAGAGAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000762
CYP2A6 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 2, subfamily A, polypeptide 6
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000762.4-802s1c1
Sequence:CCGGCGGGACTTCATTGACTCCTTTCTCGAGAAAGGAGTCAATGAAGTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000762.4-51s1c1
Sequence:CCGGCCTGACTGTAATGGTCTTGATCTCGAGATCAAGACCATTACAGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000762.4-1086s1c1
Sequence:CCGGCCAAAGATTTGGAGACGTGATCTCGAGATCACGTCTCCAAATCTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000762.4-342s1c1
Sequence:CCGGCAAAGGCTATGGCGTGGTATTCTCGAGAATACCACGCCATAGCCTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000762.4-577s1c1
Sequence:CCGGCGCTTTGACTATAAGGACAAACTCGAGTTTGTCCTTATAGTCAAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000762.5-1321s21c1
Sequence:CCGGATCGGAAAGCGGAACTGTTTCCTCGAGGAAACAGTTCCGCTTTCCGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000762.5-686s21c1
Sequence:CCGCTGTTCTCTTCGGTGATGAAACCTCGAGGTTTCATCACCGAAGAGAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)