EMAIL THIS PAGE TO A FRIEND

CYP2B6

cytochrome P450, family 2, subfamily B, polypeptide 6

19 Gene Product Result for
Synonyms: CPB6 CYP2B CYP2B7 CYP2B7P CYPIIB6 EFVM IIB1 P450
UniProtKB ID: P20813, Q2V565, Q9UK46
Gene ID:
Human(1555) Summary: This gene, CYP2B6, encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and its expression is induced by phenobarbital. The enzyme is known to metabolize some xenobiotics, such as the anti-cancer drugs cyclophosphamide and ifosphamide. Transcript variants for this gene have been described; however, it has not been resolved whether these transcripts are in fact produced by this gene or by a closely related pseudogene, CYP2B7. Both the gene and the pseudogene are located in the middle of a CYP2A pseudogene found in a large cluster of cytochrome P450 genes from the CYP2A, CYP2B and CYP2F subfamilies on chromosome 19q. [provided by RefSeq, Jul 2008]
dog(474177) cytochrome P450 2B11
cow(504769) cytochrome P450 subfamily 2B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Cell Lines

Product # Description Species Add to Cart
 
MTOXCE2B6 CypExpress 2B6 Cytochrome P450 human human pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0104 AQUA Peptide GYGVIFANGN[R] human pricing
AQ0103 AQUA Peptide HPNTHD[R] human pricing
AQ0034 AQUA Peptide YFPGAH[R] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000767 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000767 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000767 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000767 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000767 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069049 predicted 1051
2 SASI_Hs01_00069050 predicted 1061
3 SASI_Hs01_00069051 predicted 603
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000767
CYP2B6 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 2, subfamily B, polypeptide 6
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000767.4-156s1c1
Sequence:CCGGGCCTACTCAAATCCTTTCTGACTCGAGTCAGAAAGGATTTGAGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000767.4-1226s1c1
Sequence:CCGGGCCTTCAATCCTGACCACTTTCTCGAGAAAGTGGTCAGGATTGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000767.4-566s1c1
Sequence:CCGGCGATTCCACTACCAAGATCAACTCGAGTTGATCTTGGTAGTGGAATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000767.4-342s1c1
Sequence:CCGGGTGTGATCTTTGCCAATGGAACTCGAGTTCCATTGGCAAAGATCACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000767.4-718s1c1
Sequence:CCGGCCTGCAGGAAATCAATGCTTACTCGAGTAAGCATTGATTTCCTGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000767
CYP2B6 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 2, subfamily B, polypeptide 6
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000767.4-156s1c1
Sequence:CCGGGCCTACTCAAATCCTTTCTGACTCGAGTCAGAAAGGATTTGAGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000767.4-1226s1c1
Sequence:CCGGGCCTTCAATCCTGACCACTTTCTCGAGAAAGTGGTCAGGATTGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000767.4-566s1c1
Sequence:CCGGCGATTCCACTACCAAGATCAACTCGAGTTGATCTTGGTAGTGGAATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000767.4-342s1c1
Sequence:CCGGGTGTGATCTTTGCCAATGGAACTCGAGTTCCATTGGCAAAGATCACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000767.4-718s1c1
Sequence:CCGGCCTGCAGGAAATCAATGCTTACTCGAGTAAGCATTGATTTCCTGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000767
CYP2B6 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 2, subfamily B, polypeptide 6
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000767.4-156s1c1
Sequence:CCGGGCCTACTCAAATCCTTTCTGACTCGAGTCAGAAAGGATTTGAGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000767.4-1226s1c1
Sequence:CCGGGCCTTCAATCCTGACCACTTTCTCGAGAAAGTGGTCAGGATTGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000767.4-566s1c1
Sequence:CCGGCGATTCCACTACCAAGATCAACTCGAGTTGATCTTGGTAGTGGAATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000767.4-342s1c1
Sequence:CCGGGTGTGATCTTTGCCAATGGAACTCGAGTTCCATTGGCAAAGATCACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000767.4-718s1c1
Sequence:CCGGCCTGCAGGAAATCAATGCTTACTCGAGTAAGCATTGATTTCCTGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)