EMAIL THIS PAGE TO A FRIEND

CYP3A5

cytochrome P450, family 3, subfamily A, polypeptide 5

19 Gene Product Result for
Synonyms: CP35 CYPIIIA5 P450PCN3 PCN3
UniProtKB ID: P20815, A4D289, B7Z5I7, Q53WY8, Q75MV0, Q9HB56
Gene ID:
Human(1577) Summary: This gene,CYP3A5, encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and its expression is induced by glucocorticoids and some pharmacological agents. The enzyme metabolizes drugs such as nifedipine and cyclosporine as well as the steroid hormones testosterone, progesterone and androstenedione. This gene is part of a cluster of cytochrome P450 genes on chromosome 7q21.1. This cluster includes a pseudogene, CYP3A5P1, which is very similar to CYP3A5. This similarity has caused some difficulty in determining whether cloned sequences represent the gene or the pseudogene. Multiple alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Jun 2010]
cow(526682) cytochrome P450, family 3, subfamily A, polypeptide 5
cow(282214) cytochrome P450, subfamily IIIA (niphedipine oxidase), polypeptide 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0105 AQUA Peptide SLLSPTFTSG[K] human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000777 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000777 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000777 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000777 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000777 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00225785 predicted 827
2 SASI_Hs01_00225786 predicted 628
3 SASI_Hs01_00225787 predicted 786
4 SASI_Hs01_00225788 predicted 624
5 SASI_Hs01_00225789 predicted 743
6 SASI_Hs01_00225791 predicted 537
7 SASI_Hs01_00225792 predicted 300
8 SASI_Hs01_00225793 predicted 722
9 SASI_Hs01_00225794 predicted 1338
10 SASI_Hs01_00225790 predicted 784
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000777
CYP3A5 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 3, subfamily A, polypeptide 5
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000777.2-790s1c1
Sequence:CCGGGCATTAAATGTCTCTCTGTTTCTCGAGAAACAGAGAGACATTTAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000777.2-1546s1c1
Sequence:CCGGCCCATTGTTCTAAAGGTGGATCTCGAGATCCACCTTTAGAACAATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000777.2-1504s1c1
Sequence:CCGGCCCTTGAAATTAGACACGCAACTCGAGTTGCGTGTCTAATTTCAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000777.2-247s1c1
Sequence:CCGGCGTCAGGGTCTCTGGAAATTTCTCGAGAAATTTCCAGAGACCCTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000777.2-1019s1c1
Sequence:CCGGGCAGTGTTCTTTCCTTCACTTCTCGAGAAGTGAAGGAAAGAACACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000777
CYP3A5 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 3, subfamily A, polypeptide 5
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000777.2-790s1c1
Sequence:CCGGGCATTAAATGTCTCTCTGTTTCTCGAGAAACAGAGAGACATTTAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000777.2-1546s1c1
Sequence:CCGGCCCATTGTTCTAAAGGTGGATCTCGAGATCCACCTTTAGAACAATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000777.2-1504s1c1
Sequence:CCGGCCCTTGAAATTAGACACGCAACTCGAGTTGCGTGTCTAATTTCAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000777.2-247s1c1
Sequence:CCGGCGTCAGGGTCTCTGGAAATTTCTCGAGAAATTTCCAGAGACCCTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000777.2-1019s1c1
Sequence:CCGGGCAGTGTTCTTTCCTTCACTTCTCGAGAAGTGAAGGAAAGAACACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000777
CYP3A5 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 3, subfamily A, polypeptide 5
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000777.2-790s1c1
Sequence:CCGGGCATTAAATGTCTCTCTGTTTCTCGAGAAACAGAGAGACATTTAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000777.2-1546s1c1
Sequence:CCGGCCCATTGTTCTAAAGGTGGATCTCGAGATCCACCTTTAGAACAATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000777.2-1504s1c1
Sequence:CCGGCCCTTGAAATTAGACACGCAACTCGAGTTGCGTGTCTAATTTCAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000777.2-247s1c1
Sequence:CCGGCGTCAGGGTCTCTGGAAATTTCTCGAGAAATTTCCAGAGACCCTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000777.2-1019s1c1
Sequence:CCGGGCAGTGTTCTTTCCTTCACTTCTCGAGAAGTGAAGGAAAGAACACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)