EMAIL THIS PAGE TO A FRIEND

DAG1

dystroglycan 1 (dystrophin-associated glycoprotein 1)

245 Gene Product Result for
Synonyms: 156DAG A3a AGRNR DAG MDDGC7 MDDGC9
UniProtKB ID: Q14118, A8K6M7, Q969J9
Gene ID:
Human(1605) Summary: Dystroglycan is a laminin binding component of the dystrophin-glycoprotein complex which provides a linkage between the subsarcolemmal cytoskeleton and the extracellular matrix. Dystroglycan 1 is a candidate gene for the site of the mutation in autosomal recessive muscular dystrophies. The dramatic reduction of dystroglycan 1 in Duchenne muscular dystrophy leads to a loss of linkage between the sarcolemma and extracellular matrix, rendering muscle fibers more susceptible to necrosis. Dystroglycan also functions as dual receptor for agrin and laminin-2 in the Schwann cell membrane. The muscle and nonmuscle isoforms of dystroglycan differ by carbohydrate moieties but not protein sequence. Alternative splicing results in multiple transcript variants all encoding the same protein.[provided by RefSeq, Apr 2010]
Mouse(13138) dystroglycan 1
Rat(114489) dystroglycan 1 (dystrophin-associated glycoprotein 1)
sheep(101103515) dystroglycan 1 (dystrophin-associated glycoprotein 1)
Domestic Rabbit(100009278) dystroglycan 1 (dystrophin-associated glycoprotein 1)
naked mole-rat(101714190) dystroglycan 1 (dystrophin-associated glycoprotein 1)
domestic guinea pig(100734382) dystroglycan 1 (dystrophin-associated glycoprotein 1)
Zebrafish(286829) dystroglycan 1
cow(281439) dystroglycan 1 (dystrophin-associated glycoprotein 1)
Horse(100053150) dystroglycan 1 (dystrophin-associated glycoprotein 1)
domestic cat(100174781) dystroglycan 1 (dystrophin-associated glycoprotein 1)
dog(476623) dystroglycan 1 (dystrophin-associated glycoprotein 1)
chicken(100049058) dystroglycan 1 (dystrophin-associated glycoprotein 1)
Thale Cress(825358) Dof zinc finger protein DOF3.7
Gene Class: Calcium_Binding
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010017 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010017 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010017 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004393 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004393 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004393 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004393 Rosetta Predictions human pricing
XM_001074892 Rosetta Predictions rat pricing
XM_343483 Rosetta Predictions rat pricing
NM_010017 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004393 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173768 predicted 2741
2 SASI_Hs01_00173769 predicted 963
3 SASI_Hs01_00173772 predicted 778
4 SASI_Hs01_00173773 predicted 1599
5 SASI_Hs01_00173775 predicted 1614
6 SASI_Hs02_00337503 predicted 642
7 SASI_Hs02_00337504 predicted 2706
8 SASI_Hs02_00337505 predicted 2250
9 SASI_Hs02_00337506 predicted 2512
10 SASI_Hs02_00337507 predicted 511
11 SASI_Hs01_00173766 predicted 1892
12 SASI_Hs01_00173767 predicted 1963
13 SASI_Hs01_00173770 predicted 642
14 SASI_Hs01_00173771 predicted 2264
15 SASI_Hs01_00173774 predicted 1812
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074892 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00347641 predicted 1425
2 SASI_Rn02_00347642 predicted 1231
3 SASI_Rn02_00347643 predicted 2717
4 SASI_Rn02_00347644 predicted 1951
5 SASI_Rn02_00347645 predicted 1727
6 SASI_Rn02_00347646 predicted 2734
7 SASI_Rn02_00347647 predicted 2291
8 SASI_Rn02_00347648 predicted 2062
9 SASI_Rn02_00347649 predicted 2753
10 SASI_Rn02_00347650 predicted 1635
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343483 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395834 predicted 1108
2 SASI_Rn02_00395835 predicted 924
3 SASI_Rn02_00395836 predicted 2404
4 SASI_Rn02_00395837 predicted 1640
5 SASI_Rn02_00395838 predicted 1417
6 SASI_Rn02_00395839 predicted 2423
7 SASI_Rn02_00395840 predicted 1985
8 SASI_Rn02_00395841 predicted 1745
9 SASI_Rn02_00395842 predicted 2431
10 SASI_Rn02_00395843 predicted 1321
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010017 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00149059 predicted 1631
2 SASI_Mm01_00149060 predicted 2709
3 SASI_Mm01_00149061 predicted 2060
4 SASI_Mm01_00149062 predicted 1732
5 SASI_Mm01_00149063 predicted 1238
6 SASI_Mm01_00149064 predicted 2521
7 SASI_Mm01_00149065 predicted 1663
8 SASI_Mm01_00149066 predicted 2729
9 SASI_Mm01_00149067 predicted 1998
10 SASI_Mm02_00317634 predicted 2051
11 SASI_Mm01_00149068 predicted 1968
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010017
DAG1 MISSION shRNA Bacterial Glycerol Stock
dystroglycan 1 (dystrophin-associated glycoprotein 1)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010017.1-653s1c1
Sequence:CCGGCGCTCATTTCGAGTGAGCATTCTCGAGAATGCTCACTCGAAATGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010017.1-2716s1c1
Sequence:CCGGCCTGCTCATTGCTGGAATCATCTCGAGATGATTCCAGCAATGAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010017.1-1734s1c1
Sequence:CCGGCGCCTTCAACTGATTCGTCAACTCGAGTTGACGAATCAGTTGAAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119322    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010017.1-4063s1c1
Sequence:CCGGCCACCTCATCAACCTTTCTTTCTCGAGAAAGAAAGGTTGATGAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010017.1-1671s1c1
Sequence:CCGGCCGTTATTACTCCTCCAACAACTCGAGTTGTTGGAGGAGTAATAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010017.3-1733s21c1
Sequence:CCGGCGCCTTCAACTGATTCGTCAACTCGAGTTGACGAATCAGTTGAAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317229    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010017.3-4062s21c1
Sequence:CCGGCCACCTCATCAACCTTTCTTTCTCGAGAAAGAAAGGTTGATGAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010017.3-2715s21c1
Sequence:CCGGCCTGCTCATTGCTGGAATCATCTCGAGATGATTCCAGCAATGAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010017.3-652s21c1
Sequence:CCGGCGCTCATTTCGAGTGAGCATTCTCGAGAATGCTCACTCGAAATGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010017
DAG1 MISSION shRNA shRNA Plasmid DNA
dystroglycan 1 (dystrophin-associated glycoprotein 1)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010017.1-653s1c1
Sequence:CCGGCGCTCATTTCGAGTGAGCATTCTCGAGAATGCTCACTCGAAATGAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010017.1-2716s1c1
Sequence:CCGGCCTGCTCATTGCTGGAATCATCTCGAGATGATTCCAGCAATGAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010017.1-1734s1c1
Sequence:CCGGCGCCTTCAACTGATTCGTCAACTCGAGTTGACGAATCAGTTGAAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119322    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010017.1-4063s1c1
Sequence:CCGGCCACCTCATCAACCTTTCTTTCTCGAGAAAGAAAGGTTGATGAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010017.1-1671s1c1
Sequence:CCGGCCGTTATTACTCCTCCAACAACTCGAGTTGTTGGAGGAGTAATAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010017.3-1733s21c1
Sequence:CCGGCGCCTTCAACTGATTCGTCAACTCGAGTTGACGAATCAGTTGAAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317229    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010017.3-4062s21c1
Sequence:CCGGCCACCTCATCAACCTTTCTTTCTCGAGAAAGAAAGGTTGATGAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010017.3-2715s21c1
Sequence:CCGGCCTGCTCATTGCTGGAATCATCTCGAGATGATTCCAGCAATGAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010017.3-652s21c1
Sequence:CCGGCGCTCATTTCGAGTGAGCATTCTCGAGAATGCTCACTCGAAATGAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010017
DAG1 MISSION shRNA Lentiviral Transduction Particles
dystroglycan 1 (dystrophin-associated glycoprotein 1)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010017.1-653s1c1
Sequence:CCGGCGCTCATTTCGAGTGAGCATTCTCGAGAATGCTCACTCGAAATGAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010017.1-2716s1c1
Sequence:CCGGCCTGCTCATTGCTGGAATCATCTCGAGATGATTCCAGCAATGAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010017.1-1734s1c1
Sequence:CCGGCGCCTTCAACTGATTCGTCAACTCGAGTTGACGAATCAGTTGAAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119322    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010017.1-4063s1c1
Sequence:CCGGCCACCTCATCAACCTTTCTTTCTCGAGAAAGAAAGGTTGATGAGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010017.1-1671s1c1
Sequence:CCGGCCGTTATTACTCCTCCAACAACTCGAGTTGTTGGAGGAGTAATAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010017.3-1733s21c1
Sequence:CCGGCGCCTTCAACTGATTCGTCAACTCGAGTTGACGAATCAGTTGAAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317229    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010017.3-4062s21c1
Sequence:CCGGCCACCTCATCAACCTTTCTTTCTCGAGAAAGAAAGGTTGATGAGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010017.3-2715s21c1
Sequence:CCGGCCTGCTCATTGCTGGAATCATCTCGAGATGATTCCAGCAATGAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010017.3-652s21c1
Sequence:CCGGCGCTCATTTCGAGTGAGCATTCTCGAGAATGCTCACTCGAAATGAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004393
VALIDATED
DAG1 MISSION shRNA Bacterial Glycerol Stock
dystroglycan 1 (dystrophin-associated glycoprotein 1)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_004393.1-1080s1c1
Sequence:CCGGCGGTGGTGAATAACAGACTATCTCGAGATAGTCTGTTATTCACCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_004393.1-629s1c1
Sequence:CCGGCGAGTGACCATTCCAACAGATCTCGAGATCTGTTGGAATGGTCACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004393.1-2210s1c1
Sequence:CCGGGCAAGGTTCAAGGCCAAGTTTCTCGAGAAACTTGGCCTTGAACCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004393.1-2101s1c1
Sequence:CCGGCGTGGGCAAACACGAGTATTTCTCGAGAAATACTCGTGTTTGCCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_004393.1-945s1c1
Sequence:CCGGCGGATGAACCTGTGACTGTTTCTCGAGAAACAGTCACAGGTTCATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377378    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004393.2-3597s21c1
Sequence:CCGGTTACGTTTAATCTGCTGTTTACTCGAGTAAACAGCAGATTAAACGTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004393.2-1687s21c1
Sequence:CCGGCACCAAGAAGCCACGAGTATCCTCGAGGATACTCGTGGCTTCTTGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004393.2-1104s21c1
Sequence:CCGGCGGTGGTGAATAACAGACTATCTCGAGATAGTCTGTTATTCACCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312640    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_004393.2-3572s21c1
Sequence:CCGGACTTTCAGAAGTTAAGGTTAACTCGAGTTAACCTTAACTTCTGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_004393.2-2124s21c1
Sequence:CCGGACGTGGGCAAACACGAGTATTCTCGAGAATACTCGTGTTTGCCCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_004393.2-2554s21c1
Sequence:CCGGTTGTCGGCACCTACAGTTTATCTCGAGATAAACTGTAGGTGCCGACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004393
VALIDATED
DAG1 MISSION shRNA shRNA Plasmid DNA
dystroglycan 1 (dystrophin-associated glycoprotein 1)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_004393.1-1080s1c1
Sequence:CCGGCGGTGGTGAATAACAGACTATCTCGAGATAGTCTGTTATTCACCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_004393.1-629s1c1
Sequence:CCGGCGAGTGACCATTCCAACAGATCTCGAGATCTGTTGGAATGGTCACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004393.1-2210s1c1
Sequence:CCGGGCAAGGTTCAAGGCCAAGTTTCTCGAGAAACTTGGCCTTGAACCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004393.1-2101s1c1
Sequence:CCGGCGTGGGCAAACACGAGTATTTCTCGAGAAATACTCGTGTTTGCCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_004393.1-945s1c1
Sequence:CCGGCGGATGAACCTGTGACTGTTTCTCGAGAAACAGTCACAGGTTCATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377378    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004393.2-3597s21c1
Sequence:CCGGTTACGTTTAATCTGCTGTTTACTCGAGTAAACAGCAGATTAAACGTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004393.2-1687s21c1
Sequence:CCGGCACCAAGAAGCCACGAGTATCCTCGAGGATACTCGTGGCTTCTTGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004393.2-1104s21c1
Sequence:CCGGCGGTGGTGAATAACAGACTATCTCGAGATAGTCTGTTATTCACCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312640    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_004393.2-3572s21c1
Sequence:CCGGACTTTCAGAAGTTAAGGTTAACTCGAGTTAACCTTAACTTCTGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_004393.2-2124s21c1
Sequence:CCGGACGTGGGCAAACACGAGTATTCTCGAGAATACTCGTGTTTGCCCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_004393.2-2554s21c1
Sequence:CCGGTTGTCGGCACCTACAGTTTATCTCGAGATAAACTGTAGGTGCCGACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004393
VALIDATED
DAG1 MISSION shRNA Lentiviral Transduction Particles
dystroglycan 1 (dystrophin-associated glycoprotein 1)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_004393.1-1080s1c1
Sequence:CCGGCGGTGGTGAATAACAGACTATCTCGAGATAGTCTGTTATTCACCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_004393.1-629s1c1
Sequence:CCGGCGAGTGACCATTCCAACAGATCTCGAGATCTGTTGGAATGGTCACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004393.1-2210s1c1
Sequence:CCGGGCAAGGTTCAAGGCCAAGTTTCTCGAGAAACTTGGCCTTGAACCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004393.1-2101s1c1
Sequence:CCGGCGTGGGCAAACACGAGTATTTCTCGAGAAATACTCGTGTTTGCCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_004393.1-945s1c1
Sequence:CCGGCGGATGAACCTGTGACTGTTTCTCGAGAAACAGTCACAGGTTCATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377378    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004393.2-3597s21c1
Sequence:CCGGTTACGTTTAATCTGCTGTTTACTCGAGTAAACAGCAGATTAAACGTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004393.2-1687s21c1
Sequence:CCGGCACCAAGAAGCCACGAGTATCCTCGAGGATACTCGTGGCTTCTTGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004393.2-1104s21c1
Sequence:CCGGCGGTGGTGAATAACAGACTATCTCGAGATAGTCTGTTATTCACCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312640    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_004393.2-3572s21c1
Sequence:CCGGACTTTCAGAAGTTAAGGTTAACTCGAGTTAACCTTAACTTCTGAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_004393.2-2124s21c1
Sequence:CCGGACGTGGGCAAACACGAGTATTCTCGAGAATACTCGTGTTTGCCCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_004393.2-2554s21c1
Sequence:CCGGTTGTCGGCACCTACAGTTTATCTCGAGATAAACTGTAGGTGCCGACAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)