EMAIL THIS PAGE TO A FRIEND

DAZ1

deleted in azoospermia 1

46 Gene Product Result for
Synonyms: DAZ SPGY
Species: Human DAZ1(1617)
UniProtKB ID: Q9NQZ3, Q9NQZ4
Gene ID:
Human(1617) Summary: This gene is a member of the DAZ gene family and is a candidate for the human Y-chromosomal azoospermia factor (AZF). Its expression is restricted to premeiotic germ cells, particularly in spermatogonia. It encodes an RNA-binding protein that is important for spermatogenesis. Four copies of this gene are found on chromosome Y within palindromic duplications; one pair of genes is part of the P2 palindrome and the second pair is part of the P1 palindrome. Each gene contains a 2.4 kb repeat including a 72-bp exon, called the DAZ repeat; the number of DAZ repeats is variable and there are several variations in the sequence of the DAZ repeat. Each copy of the gene also contains a 10.8 kb region that may be amplified; this region includes five exons that encode an RNA recognition motif (RRM) domain. This gene contains three copies of the 10.8 kb repeat. However, no transcripts containing three copies of the RRM domain have been described; thus the RefSeq for this gene contains only two RRM domains. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004081 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004081 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004081 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU128261 MISSION® esiRNA esiRNA human DAZ1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004081 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004081 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00010413 predicted 2021
2 SASI_Hs01_00010414 predicted 2033
3 SASI_Hs01_00010415 predicted 2008
4 SASI_Hs01_00010416 predicted 379
5 SASI_Hs01_00010417 predicted 2044
6 SASI_Hs01_00010418 predicted 1964
7 SASI_Hs01_00010419 predicted 1940
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004081
DAZ1 MISSION shRNA Bacterial Glycerol Stock
deleted in azoospermia 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119017    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004081.3-1735s1c1
Sequence:CCGGCCTGATTTGAAAGCTAACAATCTCGAGATTGTTAGCTTTCAAATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004081.3-397s1c1
Sequence:CCGGCGGTTCAGTGAAAGAAGTGAACTCGAGTTCACTTCTTTCACTGAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004081.3-890s1c1
Sequence:CCGGGCTGGATATCAGTTGCCTGTACTCGAGTACAGGCAACTGATATCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004081.3-700s1c1
Sequence:CCGGCGTTCAGGCTTATTCTGCTTACTCGAGTAAGCAGAATAAGCCTGAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004081.3-540s1c1
Sequence:CCGGGCCCTGCAATCAGGAAACAAACTCGAGTTTGTTTCCTGATTGCAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004081.5-2523s21c1
Sequence:CCGGACTGATAAATTCCGTTGTTACCTCGAGGTAACAACGGAATTTATCAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004081.5-667s21c1
Sequence:CCGGGCCACGTCCTTTGGTAGTTAACTCGAGTTAACTACCAAAGGACGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004081.5-1935s21c1
Sequence:CCGGCTTATCCAAGATCACCATTTCCTCGAGGAAATGGTGATCTTGGATAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004081
DAZ1 MISSION shRNA shRNA Plasmid DNA
deleted in azoospermia 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119017    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004081.3-1735s1c1
Sequence:CCGGCCTGATTTGAAAGCTAACAATCTCGAGATTGTTAGCTTTCAAATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004081.3-397s1c1
Sequence:CCGGCGGTTCAGTGAAAGAAGTGAACTCGAGTTCACTTCTTTCACTGAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004081.3-890s1c1
Sequence:CCGGGCTGGATATCAGTTGCCTGTACTCGAGTACAGGCAACTGATATCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004081.3-700s1c1
Sequence:CCGGCGTTCAGGCTTATTCTGCTTACTCGAGTAAGCAGAATAAGCCTGAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004081.3-540s1c1
Sequence:CCGGGCCCTGCAATCAGGAAACAAACTCGAGTTTGTTTCCTGATTGCAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004081.5-2523s21c1
Sequence:CCGGACTGATAAATTCCGTTGTTACCTCGAGGTAACAACGGAATTTATCAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004081.5-667s21c1
Sequence:CCGGGCCACGTCCTTTGGTAGTTAACTCGAGTTAACTACCAAAGGACGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004081.5-1935s21c1
Sequence:CCGGCTTATCCAAGATCACCATTTCCTCGAGGAAATGGTGATCTTGGATAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004081
DAZ1 MISSION shRNA Lentiviral Transduction Particles
deleted in azoospermia 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119017    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004081.3-1735s1c1
Sequence:CCGGCCTGATTTGAAAGCTAACAATCTCGAGATTGTTAGCTTTCAAATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004081.3-397s1c1
Sequence:CCGGCGGTTCAGTGAAAGAAGTGAACTCGAGTTCACTTCTTTCACTGAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004081.3-890s1c1
Sequence:CCGGGCTGGATATCAGTTGCCTGTACTCGAGTACAGGCAACTGATATCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004081.3-700s1c1
Sequence:CCGGCGTTCAGGCTTATTCTGCTTACTCGAGTAAGCAGAATAAGCCTGAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004081.3-540s1c1
Sequence:CCGGGCCCTGCAATCAGGAAACAAACTCGAGTTTGTTTCCTGATTGCAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004081.5-2523s21c1
Sequence:CCGGACTGATAAATTCCGTTGTTACCTCGAGGTAACAACGGAATTTATCAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004081.5-667s21c1
Sequence:CCGGGCCACGTCCTTTGGTAGTTAACTCGAGTTAACTACCAAAGGACGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004081.5-1935s21c1
Sequence:CCGGCTTATCCAAGATCACCATTTCCTCGAGGAAATGGTGATCTTGGATAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)