EMAIL THIS PAGE TO A FRIEND

DCAF12L2

DDB1 and CUL4 associated factor 12-like 2

53 Gene Product Result for
Synonyms: WDR40C
UniProtKB ID: Q5VW00, B2RN42
Gene ID:
Human(340578) Summary: This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by Gly-His and Trp-Asp (GH-WD), which may facilitate formation of heterotrimeric or multi-protein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This gene appears to represent an intronless retrocopy of a related multi-exon gene located on chromosome 9. However, the CDS of this intronless gene remains intact, it is conserved in other mammalian species, it is known to be transcribed, and it is therefore thought to encode a functional protein. [provided by RefSeq, May 2010]
Mouse(245403) DDB1 and CUL4 associated factor 12-like 2
Rat(298159) DDB1 and CUL4 associated factor 12-like 2
Horse(100059984) DDB1 and CUL4 associated factor 12-like 2
dog(492114) DDB1 and CUL4 associated factor 12-like 2
cow(100336874) CG3313-like
domestic guinea pig(100722879) DDB1 and CUL4 associated factor 12-like 2
naked mole-rat(101713869) DDB1 and CUL4 associated factor 12-like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013628 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013628 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013628 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175539 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175539 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175539 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU206431 MISSION® esiRNA esiRNA targeting mouse Dcaf12l2 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013628 Rosetta Predictions human pricing
XM_001067196 Rosetta Predictions rat pricing
XM_233093 Rosetta Predictions rat pricing
NM_175539 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013628 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201317 predicted 683
2 SASI_Hs01_00201318 predicted 961
3 SASI_Hs01_00201319 predicted 376
4 SASI_Hs01_00201320 predicted 1181
5 SASI_Hs01_00201321 predicted 974
6 SASI_Hs01_00201322 predicted 1091
7 SASI_Hs01_00201323 predicted 883
8 SASI_Hs01_00201324 predicted 692
9 SASI_Hs01_00201325 predicted 1126
10 SASI_Hs01_00201326 predicted 688
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067196 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00320191 predicted 777
2 SASI_Rn02_00320192 predicted 1038
3 SASI_Rn02_00320193 predicted 913
4 SASI_Rn02_00320194 predicted 693
5 SASI_Rn02_00320195 predicted 765
6 SASI_Rn02_00320196 predicted 715
7 SASI_Rn02_00320197 predicted 915
8 SASI_Rn02_00320198 predicted 573
9 SASI_Rn02_00320199 predicted 1292
10 SASI_Rn02_00320200 predicted 1032
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_233093 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00387410 predicted 864
2 SASI_Rn02_00387411 predicted 1124
3 SASI_Rn02_00387412 predicted 1005
4 SASI_Rn02_00387413 predicted 782
5 SASI_Rn02_00387414 predicted 853
6 SASI_Rn02_00387415 predicted 806
7 SASI_Rn02_00387416 predicted 997
8 SASI_Rn02_00387417 predicted 667
9 SASI_Rn02_00387418 predicted 1381
10 SASI_Rn02_00387419 predicted 1122
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175539 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00124852 predicted 851
2 SASI_Mm01_00124854 predicted 898
3 SASI_Mm01_00124855 predicted 833
4 SASI_Mm01_00124856 predicted 1266
5 SASI_Mm01_00124857 predicted 1588
6 SASI_Mm01_00124858 predicted 1583
7 SASI_Mm01_00124859 predicted 1095
8 SASI_Mm01_00124860 predicted 1252
9 SASI_Mm01_00124861 predicted 1409
10 SASI_Mm02_00346495 predicted 1341
11 SASI_Mm01_00124853 predicted 1617
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013628
DCAF12L2 MISSION shRNA Bacterial Glycerol Stock
DDB1 and CUL4 associated factor 12-like 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013628.1-1133s21c1
Sequence:CCGGATGGTTCCCTGCTCTTCTATGCTCGAGCATAGAAGAGCAGGGAACCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013628.1-1341s21c1
Sequence:CCGGGCCGGAGATGAAGCTCTTTGTCTCGAGACAAAGAGCTTCATCTCCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013628.1-1092s21c1
Sequence:CCGGGCTGAGCTTCTACCAGCACATCTCGAGATGTGCTGGTAGAAGCTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166721    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013628.1-969s1c1
Sequence:CCGGCTGTGATGAGTTGTCCCTGTACTCGAGTACAGGGACAACTCATCACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165131    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013628.1-368s1c1
Sequence:CCGGGCACCAAGTGTAATACGCTGTCTCGAGACAGCGTATTACACTTGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162440    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013628.1-372s1c1
Sequence:CCGGCAAGTGTAATACGCTGTTTGTCTCGAGACAAACAGCGTATTACACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161330    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013628.1-700s1c1
Sequence:CCGGGACATGTTTAATGGCAGCATTCTCGAGAATGCTGCCATTAAACATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162853    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013628.1-371s1c1
Sequence:CCGGCCAAGTGTAATACGCTGTTTGCTCGAGCAAACAGCGTATTACACTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164864    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013628.1-1270s1c1
Sequence:CCGGGACGTCTGGGTGAACTACTTTCTCGAGAAAGTAGTTCACCCAGACGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013628
DCAF12L2 MISSION shRNA shRNA Plasmid DNA
DDB1 and CUL4 associated factor 12-like 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013628.1-1133s21c1
Sequence:CCGGATGGTTCCCTGCTCTTCTATGCTCGAGCATAGAAGAGCAGGGAACCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013628.1-1341s21c1
Sequence:CCGGGCCGGAGATGAAGCTCTTTGTCTCGAGACAAAGAGCTTCATCTCCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013628.1-1092s21c1
Sequence:CCGGGCTGAGCTTCTACCAGCACATCTCGAGATGTGCTGGTAGAAGCTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166721    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013628.1-969s1c1
Sequence:CCGGCTGTGATGAGTTGTCCCTGTACTCGAGTACAGGGACAACTCATCACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165131    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013628.1-368s1c1
Sequence:CCGGGCACCAAGTGTAATACGCTGTCTCGAGACAGCGTATTACACTTGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162440    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013628.1-372s1c1
Sequence:CCGGCAAGTGTAATACGCTGTTTGTCTCGAGACAAACAGCGTATTACACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161330    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013628.1-700s1c1
Sequence:CCGGGACATGTTTAATGGCAGCATTCTCGAGAATGCTGCCATTAAACATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162853    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013628.1-371s1c1
Sequence:CCGGCCAAGTGTAATACGCTGTTTGCTCGAGCAAACAGCGTATTACACTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164864    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013628.1-1270s1c1
Sequence:CCGGGACGTCTGGGTGAACTACTTTCTCGAGAAAGTAGTTCACCCAGACGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013628
DCAF12L2 MISSION shRNA Lentiviral Transduction Particles
DDB1 and CUL4 associated factor 12-like 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013628.1-1133s21c1
Sequence:CCGGATGGTTCCCTGCTCTTCTATGCTCGAGCATAGAAGAGCAGGGAACCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013628.1-1341s21c1
Sequence:CCGGGCCGGAGATGAAGCTCTTTGTCTCGAGACAAAGAGCTTCATCTCCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013628.1-1092s21c1
Sequence:CCGGGCTGAGCTTCTACCAGCACATCTCGAGATGTGCTGGTAGAAGCTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166721    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013628.1-969s1c1
Sequence:CCGGCTGTGATGAGTTGTCCCTGTACTCGAGTACAGGGACAACTCATCACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165131    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013628.1-368s1c1
Sequence:CCGGGCACCAAGTGTAATACGCTGTCTCGAGACAGCGTATTACACTTGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162440    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013628.1-372s1c1
Sequence:CCGGCAAGTGTAATACGCTGTTTGTCTCGAGACAAACAGCGTATTACACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161330    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013628.1-700s1c1
Sequence:CCGGGACATGTTTAATGGCAGCATTCTCGAGAATGCTGCCATTAAACATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162853    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013628.1-371s1c1
Sequence:CCGGCCAAGTGTAATACGCTGTTTGCTCGAGCAAACAGCGTATTACACTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164864    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013628.1-1270s1c1
Sequence:CCGGGACGTCTGGGTGAACTACTTTCTCGAGAAAGTAGTTCACCCAGACGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175539
DCAF12L2 MISSION shRNA Bacterial Glycerol Stock
DDB1 and CUL4 associated factor 12-like 2
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000202020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175539.2-1073s1c1
Sequence:CCGGCGGTATTCACACATTCGTCCACTCGAGTGGACGAATGTGTGAATACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191290    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175539.2-2665s1c1
Sequence:CCGGCGCTAATGAAATCTGACATAACTCGAGTTATGTCAGATTTCATTAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192148    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175539.2-2664s1c1
Sequence:CCGGGCGCTAATGAAATCTGACATACTCGAGTATGTCAGATTTCATTAGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175539
DCAF12L2 MISSION shRNA shRNA Plasmid DNA
DDB1 and CUL4 associated factor 12-like 2
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000202020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175539.2-1073s1c1
Sequence:CCGGCGGTATTCACACATTCGTCCACTCGAGTGGACGAATGTGTGAATACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191290    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175539.2-2665s1c1
Sequence:CCGGCGCTAATGAAATCTGACATAACTCGAGTTATGTCAGATTTCATTAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192148    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175539.2-2664s1c1
Sequence:CCGGGCGCTAATGAAATCTGACATACTCGAGTATGTCAGATTTCATTAGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175539
DCAF12L2 MISSION shRNA Lentiviral Transduction Particles
DDB1 and CUL4 associated factor 12-like 2
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000202020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175539.2-1073s1c1
Sequence:CCGGCGGTATTCACACATTCGTCCACTCGAGTGGACGAATGTGTGAATACCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191290    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175539.2-2665s1c1
Sequence:CCGGCGCTAATGAAATCTGACATAACTCGAGTTATGTCAGATTTCATTAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192148    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175539.2-2664s1c1
Sequence:CCGGGCGCTAATGAAATCTGACATACTCGAGTATGTCAGATTTCATTAGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)