EMAIL THIS PAGE TO A FRIEND

DCDC5

doublecortin domain containing 5

55 Gene Product Result for
UniProtKB ID: Q6ZRR9, B1AL47
Gene ID:
Human(100506627) Summary: This gene encodes a member of the doublecortin family. The protein encoded by this gene contains two doublecortin domains. The doublecortin domain has been demonstrated to bind tubulin and enhance microtubule polymerization. Alternatively spliced transcript variants encoding distinct isoforms have been found, but the full-length nature of some variants is not determined. [provided by RefSeq, Feb 2011]
Mouse(329482) doublecortin domain containing 5
Rat(295980) doublecortin domain containing 5
sheep(101111830) doublecortin domain containing 5
domestic cat(101086002) doublecortin domain containing 5
cow(529596) uncharacterized LOC529596
Horse(100072601) doublecortin domain containing 5
dog(475957) doublecortin domain containing 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301261 ANTI-DCDC5 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_001481324 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_001481324 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_001481324 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_177844 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177844 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177844 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU160691 MISSION® esiRNA esiRNA targeting mouse ENSMUSG00000074981 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001114621 Rosetta Predictions rat pricing
XM_230359 Rosetta Predictions rat pricing
NM_177844 Rosetta Predictions mouse pricing
XM_001481324 Rosetta Predictions mouse pricing
XM_001481330 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114621 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00252343 predicted 1034
2 SASI_Rn02_00252344 predicted 872
3 SASI_Rn02_00252345 predicted 205
4 SASI_Rn02_00252346 predicted 597
5 SASI_Rn02_00252347 predicted 888
6 SASI_Rn02_00252348 predicted 2283
7 SASI_Rn02_00252349 predicted 410
8 SASI_Rn02_00252350 predicted 1360
9 SASI_Rn02_00252351 predicted 368
10 SASI_Rn02_00252352 predicted 286
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_230359 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00386164 predicted 2719
2 SASI_Rn02_00386165 predicted 2454
3 SASI_Rn02_00386166 predicted 1722
4 SASI_Rn02_00386167 predicted 1603
5 SASI_Rn02_00386168 predicted 1662
6 SASI_Rn02_00386169 predicted 201
7 SASI_Rn02_00386170 predicted 1929
8 SASI_Rn02_00386171 predicted 2027
9 SASI_Rn02_00386172 predicted 2606
10 SASI_Rn02_00386173 predicted 1808
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177844 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00036085 predicted 661
2 SASI_Mm01_00036086 predicted 1155
3 SASI_Mm01_00036087 predicted 696
4 SASI_Mm01_00036088 predicted 1097
5 SASI_Mm01_00036089 predicted 1123
6 SASI_Mm01_00036090 predicted 598
7 SASI_Mm01_00036091 predicted 902
8 SASI_Mm01_00036092 predicted 858
9 SASI_Mm01_00036093 predicted 600
10 SASI_Mm01_00036094 predicted 695
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001481324 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00423726 predicted 3447
2 SASI_Mm02_00423727 predicted 3190
3 SASI_Mm02_00423728 predicted 3388
4 SASI_Mm02_00423729 predicted 3528
5 SASI_Mm02_00423730 predicted 3385
6 SASI_Mm02_00423731 predicted 3473
7 SASI_Mm02_00423732 predicted 3236
8 SASI_Mm02_00423733 predicted 3315
9 SASI_Mm02_00423734 predicted 3231
10 SASI_Mm02_00423735 predicted 3199
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001481330 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00423772 predicted 304
2 SASI_Mm02_00423773 predicted 539
3 SASI_Mm02_00423774 predicted 374
4 SASI_Mm02_00423775 predicted 2945
5 SASI_Mm02_00423776 predicted 1648
6 SASI_Mm02_00423777 predicted 2167
7 SASI_Mm02_00423778 predicted 432
8 SASI_Mm02_00423779 predicted 1548
9 SASI_Mm02_00423780 predicted 3029
10 SASI_Mm02_00423781 predicted 2123
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001481324
DCDC5 MISSION shRNA Bacterial Glycerol Stock
doublecortin domain containing 5
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000217750    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_001481324.1-269s1c1
Sequence:CCGGGCTGTATGTAAGACCCTAATGCTCGAGCATTAGGGTCTTACATACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216794    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_001481324.1-293s1c1
Sequence:CCGGGCTGATGCTGTTCCACTATTTCTCGAGAAATAGTGGAACAGCATCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216680    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_001481324.1-1457s1c1
Sequence:CCGGCAGCGAGATGAACTGGTATATCTCGAGATATACCAGTTCATCTCGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001481324
DCDC5 MISSION shRNA shRNA Plasmid DNA
doublecortin domain containing 5
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000217750    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_001481324.1-269s1c1
Sequence:CCGGGCTGTATGTAAGACCCTAATGCTCGAGCATTAGGGTCTTACATACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216794    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_001481324.1-293s1c1
Sequence:CCGGGCTGATGCTGTTCCACTATTTCTCGAGAAATAGTGGAACAGCATCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216680    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_001481324.1-1457s1c1
Sequence:CCGGCAGCGAGATGAACTGGTATATCTCGAGATATACCAGTTCATCTCGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001481324
DCDC5 MISSION shRNA Lentiviral Transduction Particles
doublecortin domain containing 5
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000217750    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_001481324.1-269s1c1
Sequence:CCGGGCTGTATGTAAGACCCTAATGCTCGAGCATTAGGGTCTTACATACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216794    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_001481324.1-293s1c1
Sequence:CCGGGCTGATGCTGTTCCACTATTTCTCGAGAAATAGTGGAACAGCATCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216680    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_001481324.1-1457s1c1
Sequence:CCGGCAGCGAGATGAACTGGTATATCTCGAGATATACCAGTTCATCTCGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177844
DCDC5 MISSION shRNA Bacterial Glycerol Stock
doublecortin domain containing 5
Mouse
1 Products Total
TRC Number Price Set Price (1)? Select
TRCN0000182520    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177844.1-508s1c1
Sequence:CCGGCTGAGCAGACTCAAGAGGAAACTCGAGTTTCCTCTTGAGTCTGCTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177844
DCDC5 MISSION shRNA shRNA Plasmid DNA
doublecortin domain containing 5
Mouse
1 Products Total
TRC Number Vector Price Set Price (1)? Select
TRCN0000182520    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177844.1-508s1c1
Sequence:CCGGCTGAGCAGACTCAAGAGGAAACTCGAGTTTCCTCTTGAGTCTGCTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177844
DCDC5 MISSION shRNA Lentiviral Transduction Particles
doublecortin domain containing 5
Mouse
1 Products Total
TRC Number Volume Titer Vector Price Set Price (1)? Select
TRCN0000182520    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177844.1-508s1c1
Sequence:CCGGCTGAGCAGACTCAAGAGGAAACTCGAGTTTCCTCTTGAGTCTGCTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)