EMAIL THIS PAGE TO A FRIEND

DDAH1

dimethylarginine dimethylaminohydrolase 1

169 Gene Product Result for
Synonyms: DDAH
UniProtKB ID: O94760, Q5HYC8, Q86XK5
Gene ID:
Human(23576) Summary: This gene belongs to the dimethylarginine dimethylaminohydrolase (DDAH) gene family. The encoded enzyme plays a role in nitric oxide generation by regulating cellular concentrations of methylarginines, which in turn inhibit nitric oxide synthase activity. [provided by RefSeq, Jul 2008]
Mouse(69219) dimethylarginine dimethylaminohydrolase 1
Rat(64157) dimethylarginine dimethylaminohydrolase 1
domestic guinea pig(100729503) dimethylarginine dimethylaminohydrolase 1
naked mole-rat(101712219) dimethylarginine dimethylaminohydrolase 1
sheep(101113635) dimethylarginine dimethylaminohydrolase 1
Zebrafish(114455) dimethylarginine dimethylaminohydrolase 1
chicken(378898) dimethylarginine dimethylaminohydrolase 1
dog(490182) dimethylarginine dimethylaminohydrolase 1
cow(537391) dimethylarginine dimethylaminohydrolase 1
domestic cat(101099817) dimethylarginine dimethylaminohydrolase 1
Gene Class: Amidase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012137 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012137 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012137 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026993 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026993 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026993 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012137 Rosetta Predictions human pricing
NM_022297 Rosetta Predictions rat pricing
NM_026993 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012137 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090873 predicted 740
2 SASI_Hs02_00343696 predicted 393
3 SASI_Hs01_00090874 predicted 702
4 SASI_Hs01_00090875 predicted 643
5 SASI_Hs01_00090876 predicted 750
6 SASI_Hs01_00090877 predicted 748
7 SASI_Hs01_00090878 predicted 1049
8 SASI_Hs01_00090879 predicted 1046
9 SASI_Hs01_00090880 predicted 459
10 SASI_Hs02_00343697 predicted 531
11 SASI_Hs01_00090881 predicted 788
12 SASI_Hs01_00090882 predicted 570
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022297 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00067971 predicted 1152
2 SASI_Rn01_00067972 predicted 1174
3 SASI_Rn01_00067974 predicted 441
4 SASI_Rn02_00263113 predicted 834
5 SASI_Rn01_00067975 predicted 1162
6 SASI_Rn01_00067976 predicted 1079
7 SASI_Rn02_00263114 predicted 1169
8 SASI_Rn01_00067977 predicted 695
9 SASI_Rn01_00067978 predicted 713
10 SASI_Rn02_00263115 predicted 657
11 SASI_Rn01_00067973 predicted 1206
12 SASI_Rn01_00067979 predicted 426
13 SASI_Rn01_00067980 predicted 504
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026993 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00199217 predicted 526
2 SASI_Mm02_00331353 predicted 686
3 SASI_Mm01_00199218 predicted 470
4 SASI_Mm01_00199219 predicted 859
5 SASI_Mm01_00199220 predicted 525
6 SASI_Mm01_00199221 predicted 788
7 SASI_Mm01_00199222 predicted 733
8 SASI_Mm01_00199223 predicted 721
9 SASI_Mm01_00199224 predicted 639
10 SASI_Mm01_00199225 predicted 611
11 SASI_Mm01_00199226 predicted 444
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012137
VALIDATED
DDAH1 MISSION shRNA Bacterial Glycerol Stock
dimethylarginine dimethylaminohydrolase 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_012137.2-434s1c1
Sequence:CCGGGCTCAATATAGTAGAGATGAACTCGAGTTCATCTCTACTATATTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_012137.2-662s1c1
Sequence:CCGGGTCTAGTGAATCTGCACAGAACTCGAGTTCTGTGCAGATTCACTAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_012137.2-547s1c1
Sequence:CCGGCTGAAATCTTGGCTGATACTTCTCGAGAAGTATCAGCCAAGATTTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_012137.2-686s1c1
Sequence:CCGGCCTTAAGATCATGCAACAGATCTCGAGATCTGTTGCATGATCTTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_012137.2-874s1c1
Sequence:CCGGTGAGCATGTCTGAACTGGAAACTCGAGTTTCCAGTTCAGACATGCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012137.3-728s21c1
Sequence:CCGGGTCTAGTGAATCTGCACAGAACTCGAGTTCTGTGCAGATTCACTAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012137.3-752s21c1
Sequence:CCGGCCTTAAGATCATGCAACAGATCTCGAGATCTGTTGCATGATCTTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012137.3-613s21c1
Sequence:CCGGCTGAAATCTTGGCTGATACTTCTCGAGAAGTATCAGCCAAGATTTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012137.3-940s21c1
Sequence:CCGGTGAGCATGTCTGAACTGGAAACTCGAGTTTCCAGTTCAGACATGCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012137
VALIDATED
DDAH1 MISSION shRNA shRNA Plasmid DNA
dimethylarginine dimethylaminohydrolase 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_012137.2-434s1c1
Sequence:CCGGGCTCAATATAGTAGAGATGAACTCGAGTTCATCTCTACTATATTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_012137.2-662s1c1
Sequence:CCGGGTCTAGTGAATCTGCACAGAACTCGAGTTCTGTGCAGATTCACTAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_012137.2-547s1c1
Sequence:CCGGCTGAAATCTTGGCTGATACTTCTCGAGAAGTATCAGCCAAGATTTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_012137.2-686s1c1
Sequence:CCGGCCTTAAGATCATGCAACAGATCTCGAGATCTGTTGCATGATCTTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_012137.2-874s1c1
Sequence:CCGGTGAGCATGTCTGAACTGGAAACTCGAGTTTCCAGTTCAGACATGCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012137.3-728s21c1
Sequence:CCGGGTCTAGTGAATCTGCACAGAACTCGAGTTCTGTGCAGATTCACTAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012137.3-752s21c1
Sequence:CCGGCCTTAAGATCATGCAACAGATCTCGAGATCTGTTGCATGATCTTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012137.3-613s21c1
Sequence:CCGGCTGAAATCTTGGCTGATACTTCTCGAGAAGTATCAGCCAAGATTTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012137.3-940s21c1
Sequence:CCGGTGAGCATGTCTGAACTGGAAACTCGAGTTTCCAGTTCAGACATGCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012137
VALIDATED
DDAH1 MISSION shRNA Lentiviral Transduction Particles
dimethylarginine dimethylaminohydrolase 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_012137.2-434s1c1
Sequence:CCGGGCTCAATATAGTAGAGATGAACTCGAGTTCATCTCTACTATATTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_012137.2-662s1c1
Sequence:CCGGGTCTAGTGAATCTGCACAGAACTCGAGTTCTGTGCAGATTCACTAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_012137.2-547s1c1
Sequence:CCGGCTGAAATCTTGGCTGATACTTCTCGAGAAGTATCAGCCAAGATTTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_012137.2-686s1c1
Sequence:CCGGCCTTAAGATCATGCAACAGATCTCGAGATCTGTTGCATGATCTTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_012137.2-874s1c1
Sequence:CCGGTGAGCATGTCTGAACTGGAAACTCGAGTTTCCAGTTCAGACATGCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012137.3-728s21c1
Sequence:CCGGGTCTAGTGAATCTGCACAGAACTCGAGTTCTGTGCAGATTCACTAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012137.3-752s21c1
Sequence:CCGGCCTTAAGATCATGCAACAGATCTCGAGATCTGTTGCATGATCTTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012137.3-613s21c1
Sequence:CCGGCTGAAATCTTGGCTGATACTTCTCGAGAAGTATCAGCCAAGATTTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012137.3-940s21c1
Sequence:CCGGTGAGCATGTCTGAACTGGAAACTCGAGTTTCCAGTTCAGACATGCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026993
VALIDATED
DDAH1 MISSION shRNA Bacterial Glycerol Stock
dimethylarginine dimethylaminohydrolase 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026993.1-727s1c1
Sequence:CCGGCCTCAAGATCATGCAACAGATCTCGAGATCTGTTGCATGATCTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026993.1-585s1c1
Sequence:CCGGGTGCTGAAATCTTGGCTGATACTCGAGTATCAGCCAAGATTTCAGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026993.1-884s1c1
Sequence:CCGGGAGAAACTCAAGGACCATCTACTCGAGTAGATGGTCCTTGAGTTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026993.1-639s1c1
Sequence:CCGGTGGCCGATTCTTTGCATTTAACTCGAGTTAAATGCAAAGAATCGGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026993.1-475s1c1
Sequence:CCGGGCTCAACATAGTAGAGATGAACTCGAGTTCATCTCTACTATGTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026993.3-673s21c1
Sequence:CCGGTGGCCGATTCTTTGCATTTAACTCGAGTTAAATGCAAAGAATCGGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026993.3-761s21c1
Sequence:CCGGCCTCAAGATCATGCAACAGATCTCGAGATCTGTTGCATGATCTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026993.3-509s21c1
Sequence:CCGGGCTCAACATAGTAGAGATGAACTCGAGTTCATCTCTACTATGTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026993.3-619s21c1
Sequence:CCGGGTGCTGAAATCTTGGCTGATACTCGAGTATCAGCCAAGATTTCAGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026993.3-918s21c1
Sequence:CCGGGAGAAACTCAAGGACCATCTACTCGAGTAGATGGTCCTTGAGTTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026993
VALIDATED
DDAH1 MISSION shRNA shRNA Plasmid DNA
dimethylarginine dimethylaminohydrolase 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026993.1-727s1c1
Sequence:CCGGCCTCAAGATCATGCAACAGATCTCGAGATCTGTTGCATGATCTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026993.1-585s1c1
Sequence:CCGGGTGCTGAAATCTTGGCTGATACTCGAGTATCAGCCAAGATTTCAGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026993.1-884s1c1
Sequence:CCGGGAGAAACTCAAGGACCATCTACTCGAGTAGATGGTCCTTGAGTTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026993.1-639s1c1
Sequence:CCGGTGGCCGATTCTTTGCATTTAACTCGAGTTAAATGCAAAGAATCGGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026993.1-475s1c1
Sequence:CCGGGCTCAACATAGTAGAGATGAACTCGAGTTCATCTCTACTATGTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026993.3-673s21c1
Sequence:CCGGTGGCCGATTCTTTGCATTTAACTCGAGTTAAATGCAAAGAATCGGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026993.3-761s21c1
Sequence:CCGGCCTCAAGATCATGCAACAGATCTCGAGATCTGTTGCATGATCTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026993.3-509s21c1
Sequence:CCGGGCTCAACATAGTAGAGATGAACTCGAGTTCATCTCTACTATGTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026993.3-619s21c1
Sequence:CCGGGTGCTGAAATCTTGGCTGATACTCGAGTATCAGCCAAGATTTCAGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026993.3-918s21c1
Sequence:CCGGGAGAAACTCAAGGACCATCTACTCGAGTAGATGGTCCTTGAGTTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026993
VALIDATED
DDAH1 MISSION shRNA Lentiviral Transduction Particles
dimethylarginine dimethylaminohydrolase 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026993.1-727s1c1
Sequence:CCGGCCTCAAGATCATGCAACAGATCTCGAGATCTGTTGCATGATCTTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026993.1-585s1c1
Sequence:CCGGGTGCTGAAATCTTGGCTGATACTCGAGTATCAGCCAAGATTTCAGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026993.1-884s1c1
Sequence:CCGGGAGAAACTCAAGGACCATCTACTCGAGTAGATGGTCCTTGAGTTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026993.1-639s1c1
Sequence:CCGGTGGCCGATTCTTTGCATTTAACTCGAGTTAAATGCAAAGAATCGGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026993.1-475s1c1
Sequence:CCGGGCTCAACATAGTAGAGATGAACTCGAGTTCATCTCTACTATGTTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026993.3-673s21c1
Sequence:CCGGTGGCCGATTCTTTGCATTTAACTCGAGTTAAATGCAAAGAATCGGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026993.3-761s21c1
Sequence:CCGGCCTCAAGATCATGCAACAGATCTCGAGATCTGTTGCATGATCTTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026993.3-509s21c1
Sequence:CCGGGCTCAACATAGTAGAGATGAACTCGAGTTCATCTCTACTATGTTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026993.3-619s21c1
Sequence:CCGGGTGCTGAAATCTTGGCTGATACTCGAGTATCAGCCAAGATTTCAGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026993.3-918s21c1
Sequence:CCGGGAGAAACTCAAGGACCATCTACTCGAGTAGATGGTCCTTGAGTTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)