EMAIL THIS PAGE TO A FRIEND

DDIT4

DNA-damage-inducible transcript 4

83 Gene Product Result for
Synonyms: Dig2 REDD-1 REDD1
UniProtKB ID: Q9NX09, Q9H0S3
Gene ID:
Mouse(74747) DNA-damage-inducible transcript 4
Rat(140942) DNA-damage-inducible transcript 4
Zebrafish(378866) DNA-damage-inducible transcript 4
dog(489038) DNA-damage-inducible transcript 4
cow(529235) DNA-damage-inducible transcript 4
domestic cat(101082094) DNA-damage-inducible transcript 4
sheep(101114584) DNA-damage-inducible transcript 4
naked mole-rat(101696967) DNA-damage-inducible transcript 4
domestic guinea pig(100714502) DNA-damage-inducible transcript 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029083 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029083 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029083 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_019058 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019058 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019058 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019058 Rosetta Predictions human pricing
NM_080906 Rosetta Predictions rat pricing
NM_029083 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019058 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091355 predicted 1102
2 SASI_Hs01_00091356 predicted 1399
3 SASI_Hs01_00091358 predicted 915
4 SASI_Hs01_00091359 predicted 1352
5 SASI_Hs01_00091362 predicted 978
6 SASI_Hs01_00091363 predicted 929
7 SASI_Hs01_00091364 predicted 1326
8 SASI_Hs02_00352642 predicted 922
9 SASI_Hs02_00352643 predicted 877
10 SASI_Hs02_00352644 predicted 1103
11 SASI_Hs01_00091357 predicted 478
12 SASI_Hs01_00091360 predicted 485
13 SASI_Hs01_00091361 predicted 897
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080906 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00095509 predicted 749
2 SASI_Rn01_00095510 predicted 672
3 SASI_Rn01_00095511 predicted 859
4 SASI_Rn01_00095512 predicted 1080
5 SASI_Rn01_00095513 predicted 439
6 SASI_Rn01_00095515 predicted 196
7 SASI_Rn01_00095516 predicted 717
8 SASI_Rn01_00095517 predicted 633
9 SASI_Rn01_00095518 predicted 1033
10 SASI_Rn02_00267363 predicted 558
11 SASI_Rn01_00095514 predicted 1133
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029083 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00120160 predicted 801
2 SASI_Mm01_00120161 predicted 764
3 SASI_Mm01_00120162 predicted 691
4 SASI_Mm01_00120163 predicted 799
5 SASI_Mm01_00120164 predicted 708
6 SASI_Mm01_00120165 predicted 512
7 SASI_Mm01_00120166 predicted 759
8 SASI_Mm01_00120167 predicted 720
9 SASI_Mm01_00120168 predicted 664
10 SASI_Mm01_00120169 predicted 768
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029083
VALIDATED
DDIT4 MISSION shRNA Bacterial Glycerol Stock
DNA-damage-inducible transcript 4
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193205    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029083.1-767s1c1
Sequence:CCGGCAGAGTCATCAAGAAGAAACTCTCGAGAGTTTCTTCTTGATGACTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176329    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029083.1-868s1c1
Sequence:CCGGCCCAAAGTGAAGACAAGGAATCTCGAGATTCCTTGTCTTCACTTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029083.1-701s1c1
Sequence:CCGGGTTAAGTTCTGCCAACTCTTCCTCGAGGAAGAGTTGGCAGAACTTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175158    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029083.1-1379s1c1
Sequence:CCGGGCATGAATGTAAGAGTAGGAACTCGAGTTCCTACTCTTACATTCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173460    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029083.1-327s1c1
Sequence:CCGGGAAGACTCCTCATACCTGGATCTCGAGATCCAGGTATGAGGAGTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173255    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029083.1-1422s1c1
Sequence:CCGGCGGGATCTTCGACACTTGAAACTCGAGTTTCAAGTGTCGAAGATCCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175016    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029083.1-1059s1c1
Sequence:CCGGGTAGCATGAAACAAAGGCTTACTCGAGTAAGCCTTTGTTTCATGCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217360    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029083.2-806s1c1
Sequence:CCGGGCTCATTGAAGAGTGTTGAACCTCGAGGTTCAACACTCTTCAATGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029083.2-174s21c1
Sequence:CCGGTCTTCGTCCTCGTCTCGAACTCTCGAGAGTTCGAGACGAGGACGAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277539    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029083.2-1109s21c1
Sequence:CCGGTATGTAGCATGTACCTTATTTCTCGAGAAATAAGGTACATGCTACATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029083.2-701s21c1
Sequence:CCGGGTTAAGTTCTGCCAACTCTTCCTCGAGGAAGAGTTGGCAGAACTTAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029083.2-795s21c1
Sequence:CCGGTCCGAGCAGCTGCTCATTGAACTCGAGTTCAATGAGCAGCTGCTCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029083.2-759s21c1
Sequence:CCGGACCGGCTTCAGAGTCATCAAGCTCGAGCTTGATGACTCTGAAGCCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029083
VALIDATED
DDIT4 MISSION shRNA shRNA Plasmid DNA
DNA-damage-inducible transcript 4
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193205    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029083.1-767s1c1
Sequence:CCGGCAGAGTCATCAAGAAGAAACTCTCGAGAGTTTCTTCTTGATGACTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176329    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029083.1-868s1c1
Sequence:CCGGCCCAAAGTGAAGACAAGGAATCTCGAGATTCCTTGTCTTCACTTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029083.1-701s1c1
Sequence:CCGGGTTAAGTTCTGCCAACTCTTCCTCGAGGAAGAGTTGGCAGAACTTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175158    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029083.1-1379s1c1
Sequence:CCGGGCATGAATGTAAGAGTAGGAACTCGAGTTCCTACTCTTACATTCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173460    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029083.1-327s1c1
Sequence:CCGGGAAGACTCCTCATACCTGGATCTCGAGATCCAGGTATGAGGAGTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173255    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029083.1-1422s1c1
Sequence:CCGGCGGGATCTTCGACACTTGAAACTCGAGTTTCAAGTGTCGAAGATCCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175016    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029083.1-1059s1c1
Sequence:CCGGGTAGCATGAAACAAAGGCTTACTCGAGTAAGCCTTTGTTTCATGCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217360    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029083.2-806s1c1
Sequence:CCGGGCTCATTGAAGAGTGTTGAACCTCGAGGTTCAACACTCTTCAATGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029083.2-174s21c1
Sequence:CCGGTCTTCGTCCTCGTCTCGAACTCTCGAGAGTTCGAGACGAGGACGAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277539    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029083.2-1109s21c1
Sequence:CCGGTATGTAGCATGTACCTTATTTCTCGAGAAATAAGGTACATGCTACATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029083.2-701s21c1
Sequence:CCGGGTTAAGTTCTGCCAACTCTTCCTCGAGGAAGAGTTGGCAGAACTTAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029083.2-795s21c1
Sequence:CCGGTCCGAGCAGCTGCTCATTGAACTCGAGTTCAATGAGCAGCTGCTCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029083.2-759s21c1
Sequence:CCGGACCGGCTTCAGAGTCATCAAGCTCGAGCTTGATGACTCTGAAGCCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029083
VALIDATED
DDIT4 MISSION shRNA Lentiviral Transduction Particles
DNA-damage-inducible transcript 4
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193205    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029083.1-767s1c1
Sequence:CCGGCAGAGTCATCAAGAAGAAACTCTCGAGAGTTTCTTCTTGATGACTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176329    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029083.1-868s1c1
Sequence:CCGGCCCAAAGTGAAGACAAGGAATCTCGAGATTCCTTGTCTTCACTTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029083.1-701s1c1
Sequence:CCGGGTTAAGTTCTGCCAACTCTTCCTCGAGGAAGAGTTGGCAGAACTTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175158    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029083.1-1379s1c1
Sequence:CCGGGCATGAATGTAAGAGTAGGAACTCGAGTTCCTACTCTTACATTCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173460    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029083.1-327s1c1
Sequence:CCGGGAAGACTCCTCATACCTGGATCTCGAGATCCAGGTATGAGGAGTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173255    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029083.1-1422s1c1
Sequence:CCGGCGGGATCTTCGACACTTGAAACTCGAGTTTCAAGTGTCGAAGATCCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175016    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029083.1-1059s1c1
Sequence:CCGGGTAGCATGAAACAAAGGCTTACTCGAGTAAGCCTTTGTTTCATGCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217360    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029083.2-806s1c1
Sequence:CCGGGCTCATTGAAGAGTGTTGAACCTCGAGGTTCAACACTCTTCAATGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029083.2-174s21c1
Sequence:CCGGTCTTCGTCCTCGTCTCGAACTCTCGAGAGTTCGAGACGAGGACGAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277539    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029083.2-1109s21c1
Sequence:CCGGTATGTAGCATGTACCTTATTTCTCGAGAAATAAGGTACATGCTACATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029083.2-701s21c1
Sequence:CCGGGTTAAGTTCTGCCAACTCTTCCTCGAGGAAGAGTTGGCAGAACTTAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029083.2-795s21c1
Sequence:CCGGTCCGAGCAGCTGCTCATTGAACTCGAGTTCAATGAGCAGCTGCTCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029083.2-759s21c1
Sequence:CCGGACCGGCTTCAGAGTCATCAAGCTCGAGCTTGATGACTCTGAAGCCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019058
VALIDATED
DDIT4 MISSION shRNA Bacterial Glycerol Stock
DNA-damage-inducible transcript 4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062418    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019058.2-1429s1c1
Sequence:CCGGGCTATCTTACAGACGCATGAACTCGAGTTCATGCGTCTGTAAGATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019058.2-461s1c1
Sequence:CCGGCCTGAGGATGAACACTTGTGTCTCGAGACACAAGTGTTCATCCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019058.2-879s1c1
Sequence:CCGGAGCTGCTCATTGAGGAGTGTTCTCGAGAACACTCCTCAATGAGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019058.2-397s1c1
Sequence:CCGGGCCGGAGGAAGACACGGCTTACTCGAGTAAGCCGTGTCTTCCTCCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_019058.2-555s1c1
Sequence:CCGGTGATGCCTAGCCAGTTGGTAACTCGAGTTACCAACTGGCTAGGCATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000449505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019058.2-577s21c1
Sequence:CCGGCCAGGTGGGCAAAGAACTACTCTCGAGAGTAGTTCTTTGCCCACCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000443146    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019058.2-1165s21c1
Sequence:CCGGGTGTAGCATGTACCTTATTATCTCGAGATAATAAGGTACATGCTACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019058
VALIDATED
DDIT4 MISSION shRNA shRNA Plasmid DNA
DNA-damage-inducible transcript 4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062418    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019058.2-1429s1c1
Sequence:CCGGGCTATCTTACAGACGCATGAACTCGAGTTCATGCGTCTGTAAGATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019058.2-461s1c1
Sequence:CCGGCCTGAGGATGAACACTTGTGTCTCGAGACACAAGTGTTCATCCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019058.2-879s1c1
Sequence:CCGGAGCTGCTCATTGAGGAGTGTTCTCGAGAACACTCCTCAATGAGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019058.2-397s1c1
Sequence:CCGGGCCGGAGGAAGACACGGCTTACTCGAGTAAGCCGTGTCTTCCTCCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_019058.2-555s1c1
Sequence:CCGGTGATGCCTAGCCAGTTGGTAACTCGAGTTACCAACTGGCTAGGCATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000449505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019058.2-577s21c1
Sequence:CCGGCCAGGTGGGCAAAGAACTACTCTCGAGAGTAGTTCTTTGCCCACCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000443146    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019058.2-1165s21c1
Sequence:CCGGGTGTAGCATGTACCTTATTATCTCGAGATAATAAGGTACATGCTACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019058
VALIDATED
DDIT4 MISSION shRNA Lentiviral Transduction Particles
DNA-damage-inducible transcript 4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062418    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019058.2-1429s1c1
Sequence:CCGGGCTATCTTACAGACGCATGAACTCGAGTTCATGCGTCTGTAAGATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019058.2-461s1c1
Sequence:CCGGCCTGAGGATGAACACTTGTGTCTCGAGACACAAGTGTTCATCCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019058.2-879s1c1
Sequence:CCGGAGCTGCTCATTGAGGAGTGTTCTCGAGAACACTCCTCAATGAGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019058.2-397s1c1
Sequence:CCGGGCCGGAGGAAGACACGGCTTACTCGAGTAAGCCGTGTCTTCCTCCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_019058.2-555s1c1
Sequence:CCGGTGATGCCTAGCCAGTTGGTAACTCGAGTTACCAACTGGCTAGGCATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000449505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019058.2-577s21c1
Sequence:CCGGCCAGGTGGGCAAAGAACTACTCTCGAGAGTAGTTCTTTGCCCACCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000443146    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019058.2-1165s21c1
Sequence:CCGGGTGTAGCATGTACCTTATTATCTCGAGATAATAAGGTACATGCTACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)