EMAIL THIS PAGE TO A FRIEND

DDX3X

DEAD (Asp-Glu-Ala-Asp) box helicase 3, X-linked

260 Gene Product Result for
Synonyms: DBX DDX14 DDX3 HLP2
UniProtKB ID: O00571, A8K538, B4E3E8, O15536
Gene ID:
Human(1654) Summary: DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which interacts specifically with hepatitis C virus core protein resulting a change in intracellular location. This gene has a homolog located in the nonrecombining region of the Y chromosome. The protein sequence is 91% identical between this gene and the Y-linked homolog. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Jul 2010]
Mouse(13205) DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 3, X-linked
Rat(317335) DEAD (Asp-Glu-Ala-Asp) box helicase 3, X-linked
chicken(418567) DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked
dog(480886) DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked
domestic cat(101090417) DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked
cow(510093) DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked
sheep(101104719) DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked
Domestic Rabbit(100348597) DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked
naked mole-rat(101700551) DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked
domestic guinea pig(100731556) DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB3500206 Anti-DDX3 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse
ELISA, immunocytochemistry, immunofluorescence, western blot pricing
SAB4500637 Anti-DDX3 antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB1306258 ANTI-DDX3(C-TERMINAL) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing
HPA001648 Anti-DDX3X antibody produced in rabbit Ab1, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, mouse, rat
immunofluorescence, immunohistochemistry, western blot pricing
HPA005631 Anti-DDX3X antibody produced in rabbit Ab2, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, mouse, human
immunofluorescence, immunohistochemistry, western blot pricing
HPA059585 Anti-DDX3X antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunohistochemistry pricing
SAB2104311 Anti-DDX3X, (N-terminal) antibody produced in rabbit affinity isolated antibody horse, rabbit, human, guinea pig, rat, canine, mouse
immunohistochemistry, western blot pricing
SAB4504166 Anti-phospho-DDX3/DEAD-box Protein 3 (pThr322) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001356 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001356 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001356 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010028 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010028 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010028 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001356 Rosetta Predictions human pricing
NM_001108246 Rosetta Predictions rat pricing
NM_010028 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001356 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172806 predicted 2170
2 SASI_Hs01_00172807 predicted 1222
3 SASI_Hs01_00172808 predicted 1869
4 SASI_Hs01_00172809 predicted 1333
5 SASI_Hs01_00172810 predicted 2147
6 SASI_Hs02_00331691 predicted 1154
7 SASI_Hs02_00331692 predicted 998
8 SASI_Hs01_00172813 predicted 1676
9 SASI_Hs01_00172814 predicted 2271
10 SASI_Hs01_00172815 predicted 1656
11 SASI_Hs01_00172811 predicted 1924
12 SASI_Hs01_00172812 predicted 1292
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108246 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236764 predicted 1567
2 SASI_Rn02_00236765 predicted 1126
3 SASI_Rn02_00236766 predicted 1622
4 SASI_Rn02_00236767 predicted 991
5 SASI_Rn02_00236768 predicted 1573
6 SASI_Rn02_00236769 predicted 1115
7 SASI_Rn02_00236770 predicted 1064
8 SASI_Rn02_00236771 predicted 876
9 SASI_Rn02_00236772 predicted 993
10 SASI_Rn02_00236773 predicted 1012
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010028 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00136682 predicted 1846
2 SASI_Mm01_00136683 predicted 603
3 SASI_Mm01_00136684 predicted 230
4 SASI_Mm01_00136685 predicted 1083
5 SASI_Mm01_00136686 predicted 1271
6 SASI_Mm01_00136687 predicted 992
7 SASI_Mm01_00136688 predicted 861
8 SASI_Mm01_00136689 predicted 581
9 SASI_Mm02_00317678 predicted 570
10 SASI_Mm01_00136691 predicted 1442
11 SASI_Mm01_00136690 predicted 777
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001356
VALIDATED
DDX3X MISSION shRNA Bacterial Glycerol Stock
DEAD (Asp-Glu-Ala-Asp) box helicase 3, X-linked
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000314600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001356.3-1939s21c1
Sequence:CCGGCGTAGAATAGTCGAACAAGATCTCGAGATCTTGTTCGACTATTCTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001356.3-2125s21c1
Sequence:CCGGGAATCAGACAAACGGTCATTTCTCGAGAAATGACCGTTTGTCTGATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314601    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001356.3-2865s21c1
Sequence:CCGGCCCTGCCAAACAAGCTAATATCTCGAGATATTAGCTTGTTTGGCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001356.3-1001s21c1
Sequence:CCGGCTAAAGGTTTCTACGATAAAGCTCGAGCTTTATCGTAGAAACCTTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000001    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_001356.x-2866s1c1
Sequence:CCGGCCCTGCCAAACAAGCTAATATCTCGAGATATTAGCTTGTTTGGCAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001356.x-1289s1c1
Sequence:CCGGCGCTTGGAACAGGAACTCTTTCTCGAGAAAGAGTTCCTGTTCCAAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001356.x-2627s1c1
Sequence:CCGGAGCAGATTTAGTGGAGGGTTTCTCGAGAAACCCTCCACTAAATCTGCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_001356.x-1940s1c1
Sequence:CCGGCGTAGAATAGTCGAACAAGATCTCGAGATCTTGTTCGACTATTCTACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_001356.x-1157s1c1
Sequence:CCGGCGGAGTGATTACGATGGCATTCTCGAGAATGCCATCGTAATCACTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001356
VALIDATED
DDX3X MISSION shRNA shRNA Plasmid DNA
DEAD (Asp-Glu-Ala-Asp) box helicase 3, X-linked
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000314600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001356.3-1939s21c1
Sequence:CCGGCGTAGAATAGTCGAACAAGATCTCGAGATCTTGTTCGACTATTCTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001356.3-2125s21c1
Sequence:CCGGGAATCAGACAAACGGTCATTTCTCGAGAAATGACCGTTTGTCTGATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314601    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001356.3-2865s21c1
Sequence:CCGGCCCTGCCAAACAAGCTAATATCTCGAGATATTAGCTTGTTTGGCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001356.3-1001s21c1
Sequence:CCGGCTAAAGGTTTCTACGATAAAGCTCGAGCTTTATCGTAGAAACCTTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000001    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_001356.x-2866s1c1
Sequence:CCGGCCCTGCCAAACAAGCTAATATCTCGAGATATTAGCTTGTTTGGCAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001356.x-1289s1c1
Sequence:CCGGCGCTTGGAACAGGAACTCTTTCTCGAGAAAGAGTTCCTGTTCCAAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001356.x-2627s1c1
Sequence:CCGGAGCAGATTTAGTGGAGGGTTTCTCGAGAAACCCTCCACTAAATCTGCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_001356.x-1940s1c1
Sequence:CCGGCGTAGAATAGTCGAACAAGATCTCGAGATCTTGTTCGACTATTCTACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_001356.x-1157s1c1
Sequence:CCGGCGGAGTGATTACGATGGCATTCTCGAGAATGCCATCGTAATCACTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001356
VALIDATED
DDX3X MISSION shRNA Lentiviral Transduction Particles
DEAD (Asp-Glu-Ala-Asp) box helicase 3, X-linked
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000314600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001356.3-1939s21c1
Sequence:CCGGCGTAGAATAGTCGAACAAGATCTCGAGATCTTGTTCGACTATTCTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001356.3-2125s21c1
Sequence:CCGGGAATCAGACAAACGGTCATTTCTCGAGAAATGACCGTTTGTCTGATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314601    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001356.3-2865s21c1
Sequence:CCGGCCCTGCCAAACAAGCTAATATCTCGAGATATTAGCTTGTTTGGCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001356.3-1001s21c1
Sequence:CCGGCTAAAGGTTTCTACGATAAAGCTCGAGCTTTATCGTAGAAACCTTTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000001    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_001356.x-2866s1c1
Sequence:CCGGCCCTGCCAAACAAGCTAATATCTCGAGATATTAGCTTGTTTGGCAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001356.x-1289s1c1
Sequence:CCGGCGCTTGGAACAGGAACTCTTTCTCGAGAAAGAGTTCCTGTTCCAAGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001356.x-2627s1c1
Sequence:CCGGAGCAGATTTAGTGGAGGGTTTCTCGAGAAACCCTCCACTAAATCTGCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_001356.x-1940s1c1
Sequence:CCGGCGTAGAATAGTCGAACAAGATCTCGAGATCTTGTTCGACTATTCTACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_001356.x-1157s1c1
Sequence:CCGGCGGAGTGATTACGATGGCATTCTCGAGAATGCCATCGTAATCACTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010028
VALIDATED
DDX3X MISSION shRNA Bacterial Glycerol Stock
DEAD (Asp-Glu-Ala-Asp) box helicase 3, X-linked
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000287236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010028.3-1849s21c1
Sequence:CCGGACGTTCTAAGAGCAGTCGATTCTCGAGAATCGACTGCTCTTAGAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010028.3-268s21c1
Sequence:CCGGGTGGAGTTCTAGTAAAGATAACTCGAGTTATCTTTACTAGAACTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010028.3-1713s21c1
Sequence:CCGGCCACCTCATTCTTTAATGAAACTCGAGTTTCATTAAAGAATGAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287305    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010028.3-2188s21c1
Sequence:CCGGGCTGTGATTCTCCACTGAAATCTCGAGATTTCAGTGGAGAATCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010028.3-187s21c1
Sequence:CCGGAGCAAGCAAAGGGCGTTATATCTCGAGATATAACGCCCTTTGCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103750    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010028.1-2172s1c1
Sequence:CCGGGCTGTGATTCTCCACTGAAATCTCGAGATTTCAGTGGAGAATCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010028.1-252s1c1
Sequence:CCGGGTGGAGTTCTAGTAAAGATAACTCGAGTTATCTTTACTAGAACTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010028.1-1254s1c1
Sequence:CCGGCCGTGATTTCTTAGATGAGTACTCGAGTACTCATCTAAGAAATCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010028.1-1697s1c1
Sequence:CCGGCCACCTCATTCTTTAATGAAACTCGAGTTTCATTAAAGAATGAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010028.1-1833s1c1
Sequence:CCGGACGTTCTAAGAGCAGTCGATTCTCGAGAATCGACTGCTCTTAGAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010028
VALIDATED
DDX3X MISSION shRNA shRNA Plasmid DNA
DEAD (Asp-Glu-Ala-Asp) box helicase 3, X-linked
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000287236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010028.3-1849s21c1
Sequence:CCGGACGTTCTAAGAGCAGTCGATTCTCGAGAATCGACTGCTCTTAGAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010028.3-268s21c1
Sequence:CCGGGTGGAGTTCTAGTAAAGATAACTCGAGTTATCTTTACTAGAACTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010028.3-1713s21c1
Sequence:CCGGCCACCTCATTCTTTAATGAAACTCGAGTTTCATTAAAGAATGAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287305    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010028.3-2188s21c1
Sequence:CCGGGCTGTGATTCTCCACTGAAATCTCGAGATTTCAGTGGAGAATCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010028.3-187s21c1
Sequence:CCGGAGCAAGCAAAGGGCGTTATATCTCGAGATATAACGCCCTTTGCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103750    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010028.1-2172s1c1
Sequence:CCGGGCTGTGATTCTCCACTGAAATCTCGAGATTTCAGTGGAGAATCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010028.1-252s1c1
Sequence:CCGGGTGGAGTTCTAGTAAAGATAACTCGAGTTATCTTTACTAGAACTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010028.1-1254s1c1
Sequence:CCGGCCGTGATTTCTTAGATGAGTACTCGAGTACTCATCTAAGAAATCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010028.1-1697s1c1
Sequence:CCGGCCACCTCATTCTTTAATGAAACTCGAGTTTCATTAAAGAATGAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010028.1-1833s1c1
Sequence:CCGGACGTTCTAAGAGCAGTCGATTCTCGAGAATCGACTGCTCTTAGAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010028
VALIDATED
DDX3X MISSION shRNA Lentiviral Transduction Particles
DEAD (Asp-Glu-Ala-Asp) box helicase 3, X-linked
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000287236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010028.3-1849s21c1
Sequence:CCGGACGTTCTAAGAGCAGTCGATTCTCGAGAATCGACTGCTCTTAGAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010028.3-268s21c1
Sequence:CCGGGTGGAGTTCTAGTAAAGATAACTCGAGTTATCTTTACTAGAACTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010028.3-1713s21c1
Sequence:CCGGCCACCTCATTCTTTAATGAAACTCGAGTTTCATTAAAGAATGAGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287305    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010028.3-2188s21c1
Sequence:CCGGGCTGTGATTCTCCACTGAAATCTCGAGATTTCAGTGGAGAATCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010028.3-187s21c1
Sequence:CCGGAGCAAGCAAAGGGCGTTATATCTCGAGATATAACGCCCTTTGCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103750    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010028.1-2172s1c1
Sequence:CCGGGCTGTGATTCTCCACTGAAATCTCGAGATTTCAGTGGAGAATCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010028.1-252s1c1
Sequence:CCGGGTGGAGTTCTAGTAAAGATAACTCGAGTTATCTTTACTAGAACTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010028.1-1254s1c1
Sequence:CCGGCCGTGATTTCTTAGATGAGTACTCGAGTACTCATCTAAGAAATCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010028.1-1697s1c1
Sequence:CCGGCCACCTCATTCTTTAATGAAACTCGAGTTTCATTAAAGAATGAGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010028.1-1833s1c1
Sequence:CCGGACGTTCTAAGAGCAGTCGATTCTCGAGAATCGACTGCTCTTAGAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)