EMAIL THIS PAGE TO A FRIEND

DEFB132

defensin, beta 132

42 Gene Product Result for
Synonyms: DEFB32 UNQ827
UniProtKB ID: Q7Z7B7, B2RP72, Q4QY40
Gene ID:
dog(100683082) defensin, beta 132
naked mole-rat(101718966) defensin, beta 132
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207469 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207469 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207469 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207469 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207469 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145623 predicted 306
2 SASI_Hs01_00145624 predicted 329
3 SASI_Hs01_00145625 predicted 309
4 SASI_Hs01_00145626 predicted 497
5 SASI_Hs01_00145627 predicted 341
6 SASI_Hs02_00374104 predicted 365
7 SASI_Hs01_00145628 predicted 313
8 SASI_Hs01_00145629 predicted 234
9 SASI_Hs01_00145630 predicted 459
10 SASI_Hs01_00145631 predicted 163
11 SASI_Hs01_00145632 predicted 247
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207469
DEFB132 MISSION shRNA Bacterial Glycerol Stock
defensin, beta 132
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207469.1-176s1c1
Sequence:CCGGGCATTGTTCATGTGCAACGCTCTCGAGAGCGTTGCACATGAACAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133706    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207469.1-277s1c1
Sequence:CCGGGAGAAGAAACACACAAAGGAACTCGAGTTCCTTTGTGTGTTTCTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133782    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207469.1-286s1c1
Sequence:CCGGCACACAAAGGAAAGACAAGAACTCGAGTTCTTGTCTTTCCTTTGTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133937    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207469.1-290s1c1
Sequence:CCGGCAAAGGAAAGACAAGAAGCAACTCGAGTTGCTTCTTGTCTTTCCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134878    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207469.1-1734s1c1
Sequence:CCGGCCATTCCCTAACTTATGTCTTCTCGAGAAGACATAAGTTAGGGAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134942    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207469.1-1311s1c1
Sequence:CCGGCCAAGAGAAAGCACAAAGTTACTCGAGTAACTTTGTGCTTTCTCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135007    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207469.1-273s1c1
Sequence:CCGGCAAGGAGAAGAAACACACAAACTCGAGTTTGTGTGTTTCTTCTCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138312    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207469.1-138s1c1
Sequence:CCGGCAGGATACTGCAGGACATGTTCTCGAGAACATGTCCTGCAGTATCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137663    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207469.1-375s1c1
Sequence:CCGGCCACAGTTCCAATTCCTCCTACTCGAGTAGGAGGAATTGGAACTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137553    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207469.1-301s1c1
Sequence:CCGGCAAGAAGCAACAAACGACCGTCTCGAGACGGTCGTTTGTTGCTTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137947    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207469.1-307s1c1
Sequence:CCGGGCAACAAACGACCGTAACATCCTCGAGGATGTTACGGTCGTTTGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207469.1-184s1c1
Sequence:CCGGCATGTGCAACGCTTCCAGAAACTCGAGTTTCTGGAAGCGTTGCACATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138567    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207469.1-263s1c1
Sequence:CCGGCACTGGCAATCAAGGAGAAGACTCGAGTCTTCTCCTTGATTGCCAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207469
DEFB132 MISSION shRNA shRNA Plasmid DNA
defensin, beta 132
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207469.1-176s1c1
Sequence:CCGGGCATTGTTCATGTGCAACGCTCTCGAGAGCGTTGCACATGAACAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133706    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207469.1-277s1c1
Sequence:CCGGGAGAAGAAACACACAAAGGAACTCGAGTTCCTTTGTGTGTTTCTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133782    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207469.1-286s1c1
Sequence:CCGGCACACAAAGGAAAGACAAGAACTCGAGTTCTTGTCTTTCCTTTGTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133937    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207469.1-290s1c1
Sequence:CCGGCAAAGGAAAGACAAGAAGCAACTCGAGTTGCTTCTTGTCTTTCCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134878    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207469.1-1734s1c1
Sequence:CCGGCCATTCCCTAACTTATGTCTTCTCGAGAAGACATAAGTTAGGGAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134942    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207469.1-1311s1c1
Sequence:CCGGCCAAGAGAAAGCACAAAGTTACTCGAGTAACTTTGTGCTTTCTCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135007    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207469.1-273s1c1
Sequence:CCGGCAAGGAGAAGAAACACACAAACTCGAGTTTGTGTGTTTCTTCTCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138312    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207469.1-138s1c1
Sequence:CCGGCAGGATACTGCAGGACATGTTCTCGAGAACATGTCCTGCAGTATCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137663    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207469.1-375s1c1
Sequence:CCGGCCACAGTTCCAATTCCTCCTACTCGAGTAGGAGGAATTGGAACTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137553    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207469.1-301s1c1
Sequence:CCGGCAAGAAGCAACAAACGACCGTCTCGAGACGGTCGTTTGTTGCTTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137947    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207469.1-307s1c1
Sequence:CCGGGCAACAAACGACCGTAACATCCTCGAGGATGTTACGGTCGTTTGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207469.1-184s1c1
Sequence:CCGGCATGTGCAACGCTTCCAGAAACTCGAGTTTCTGGAAGCGTTGCACATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138567    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207469.1-263s1c1
Sequence:CCGGCACTGGCAATCAAGGAGAAGACTCGAGTCTTCTCCTTGATTGCCAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207469
DEFB132 MISSION shRNA Lentiviral Transduction Particles
defensin, beta 132
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207469.1-176s1c1
Sequence:CCGGGCATTGTTCATGTGCAACGCTCTCGAGAGCGTTGCACATGAACAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133706    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207469.1-277s1c1
Sequence:CCGGGAGAAGAAACACACAAAGGAACTCGAGTTCCTTTGTGTGTTTCTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133782    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207469.1-286s1c1
Sequence:CCGGCACACAAAGGAAAGACAAGAACTCGAGTTCTTGTCTTTCCTTTGTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133937    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207469.1-290s1c1
Sequence:CCGGCAAAGGAAAGACAAGAAGCAACTCGAGTTGCTTCTTGTCTTTCCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134878    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207469.1-1734s1c1
Sequence:CCGGCCATTCCCTAACTTATGTCTTCTCGAGAAGACATAAGTTAGGGAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134942    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207469.1-1311s1c1
Sequence:CCGGCCAAGAGAAAGCACAAAGTTACTCGAGTAACTTTGTGCTTTCTCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135007    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207469.1-273s1c1
Sequence:CCGGCAAGGAGAAGAAACACACAAACTCGAGTTTGTGTGTTTCTTCTCCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138312    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207469.1-138s1c1
Sequence:CCGGCAGGATACTGCAGGACATGTTCTCGAGAACATGTCCTGCAGTATCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137663    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207469.1-375s1c1
Sequence:CCGGCCACAGTTCCAATTCCTCCTACTCGAGTAGGAGGAATTGGAACTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137553    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207469.1-301s1c1
Sequence:CCGGCAAGAAGCAACAAACGACCGTCTCGAGACGGTCGTTTGTTGCTTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137947    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207469.1-307s1c1
Sequence:CCGGGCAACAAACGACCGTAACATCCTCGAGGATGTTACGGTCGTTTGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207469.1-184s1c1
Sequence:CCGGCATGTGCAACGCTTCCAGAAACTCGAGTTTCTGGAAGCGTTGCACATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138567    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207469.1-263s1c1
Sequence:CCGGCACTGGCAATCAAGGAGAAGACTCGAGTCTTCTCCTTGATTGCCAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)