EMAIL THIS PAGE TO A FRIEND

DEFB136

defensin, beta 136

16 Gene Product Result for
Synonyms: DEFB137
UniProtKB ID: Q30KP8, Q4QY36
Gene ID:
naked mole-rat(101709375) defensin, beta 136
dog(100684086) defensin, beta 136
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033018 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001033018 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001033018 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033018 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033018 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212933 predicted 140
2 SASI_Hs01_00212934 predicted 58
3 SASI_Hs01_00212935 predicted 102
4 SASI_Hs01_00212936 predicted 136
5 SASI_Hs01_00212937 predicted 138
6 SASI_Hs01_00212938 predicted 95
7 SASI_Hs01_00212939 predicted 145
8 SASI_Hs01_00212940 predicted 162
9 SASI_Hs01_00212941 predicted 103
10 SASI_Hs01_00212942 predicted 127
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033018
DEFB136 MISSION shRNA Bacterial Glycerol Stock
defensin, beta 136
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033018.2-151s21c1
Sequence:CCGGATTGCGTTCTGCCACAATATTCTCGAGAATATTGTGGCAGAACGCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033018.2-216s21c1
Sequence:CCGGCAAAGATCCATGGGTTCATTACTCGAGTAATGAACCCATGGATCTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033018.2-99s21c1
Sequence:CCGGCACTAGCCAGAAAGCCGTATGCTCGAGCATACGGCTTTCTGGCTAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033018.2-39s21c1
Sequence:CCGGGATCTTACTGCCTTCAGGAAACTCGAGTTTCCTGAAGGCAGTAAGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033018.2-68s21c1
Sequence:CCGGTTGGGAATGATGGAGTCAAAGCTCGAGCTTTGACTCCATCATTCCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033018
DEFB136 MISSION shRNA shRNA Plasmid DNA
defensin, beta 136
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033018.2-151s21c1
Sequence:CCGGATTGCGTTCTGCCACAATATTCTCGAGAATATTGTGGCAGAACGCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033018.2-216s21c1
Sequence:CCGGCAAAGATCCATGGGTTCATTACTCGAGTAATGAACCCATGGATCTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033018.2-99s21c1
Sequence:CCGGCACTAGCCAGAAAGCCGTATGCTCGAGCATACGGCTTTCTGGCTAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033018.2-39s21c1
Sequence:CCGGGATCTTACTGCCTTCAGGAAACTCGAGTTTCCTGAAGGCAGTAAGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033018.2-68s21c1
Sequence:CCGGTTGGGAATGATGGAGTCAAAGCTCGAGCTTTGACTCCATCATTCCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033018
DEFB136 MISSION shRNA Lentiviral Transduction Particles
defensin, beta 136
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033018.2-151s21c1
Sequence:CCGGATTGCGTTCTGCCACAATATTCTCGAGAATATTGTGGCAGAACGCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033018.2-216s21c1
Sequence:CCGGCAAAGATCCATGGGTTCATTACTCGAGTAATGAACCCATGGATCTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033018.2-99s21c1
Sequence:CCGGCACTAGCCAGAAAGCCGTATGCTCGAGCATACGGCTTTCTGGCTAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033018.2-39s21c1
Sequence:CCGGGATCTTACTGCCTTCAGGAAACTCGAGTTTCCTGAAGGCAGTAAGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033018.2-68s21c1
Sequence:CCGGTTGGGAATGATGGAGTCAAAGCTCGAGCTTTGACTCCATCATTCCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)