EMAIL THIS PAGE TO A FRIEND

Defb3

25 Gene Product Result for
Gene ID:
Rat(641623) beta-defensin 3
Horse(100629479) beta-defensin 1-like
cow(101906662) defensin beta 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
D2444 Anti-β-Defensin 3 antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013756 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013756 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013756 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001037548 Rosetta Predictions rat pricing
NM_013756 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037548 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00036563 predicted 76
2 SASI_Rn01_00036564 predicted 134
3 SASI_Rn02_00204490 predicted 106
4 SASI_Rn01_00036565 predicted 151
5 SASI_Rn01_00036567 predicted 142
6 SASI_Rn01_00036570 predicted 96
7 SASI_Rn02_00204491 predicted 114
8 SASI_Rn02_00204492 predicted 107
9 SASI_Rn01_00036571 predicted 97
10 SASI_Rn01_00036572 predicted 99
11 SASI_Rn01_00036566 predicted 77
12 SASI_Rn01_00036568 predicted 89
13 SASI_Rn01_00036569 predicted 98
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013756 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00193071 predicted 92
2 SASI_Mm01_00193072 predicted 119
3 SASI_Mm01_00193073 predicted 205
4 SASI_Mm01_00193074 predicted 272
5 SASI_Mm01_00193075 predicted 87
6 SASI_Mm01_00193076 predicted 134
7 SASI_Mm01_00193077 predicted 108
8 SASI_Mm01_00193078 predicted 203
9 SASI_Mm01_00193079 predicted 87
10 SASI_Mm02_00322703 predicted 165
11 SASI_Mm01_00193080 predicted 149
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013756
Defb3 MISSION shRNA Bacterial Glycerol Stock
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000099407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013756.1-135s1c1
Sequence:CCGGCATTGGCAACACTCGTCAGATCTCGAGATCTGACGAGTGTTGCCAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013756.1-91s1c1
Sequence:CCGGCCAGTAAGTTGTTTGAGGAAACTCGAGTTTCCTCAAACAACTTACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013756.1-118s1c1
Sequence:CCGGAGATGCTGGAATCGGTGCATTCTCGAGAATGCACCGATTCCAGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013756
Defb3 MISSION shRNA shRNA Plasmid DNA
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000099407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013756.1-135s1c1
Sequence:CCGGCATTGGCAACACTCGTCAGATCTCGAGATCTGACGAGTGTTGCCAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013756.1-91s1c1
Sequence:CCGGCCAGTAAGTTGTTTGAGGAAACTCGAGTTTCCTCAAACAACTTACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013756.1-118s1c1
Sequence:CCGGAGATGCTGGAATCGGTGCATTCTCGAGAATGCACCGATTCCAGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013756
Defb3 MISSION shRNA Lentiviral Transduction Particles
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000099407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013756.1-135s1c1
Sequence:CCGGCATTGGCAACACTCGTCAGATCTCGAGATCTGACGAGTGTTGCCAATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013756.1-91s1c1
Sequence:CCGGCCAGTAAGTTGTTTGAGGAAACTCGAGTTTCCTCAAACAACTTACTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013756.1-118s1c1
Sequence:CCGGAGATGCTGGAATCGGTGCATTCTCGAGAATGCACCGATTCCAGCATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)