EMAIL THIS PAGE TO A FRIEND

Defb4

22 Gene Product Result for
Gene ID:
Rat(64389) defensin beta 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019728 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019728 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019728 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022544 Rosetta Predictions rat pricing
NM_019728 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022544 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00092425 predicted 343
2 SASI_Rn01_00092426 predicted 190
3 SASI_Rn01_00092427 predicted 299
4 SASI_Rn01_00092428 predicted 194
5 SASI_Rn01_00092429 predicted 383
6 SASI_Rn01_00092430 predicted 284
7 SASI_Rn01_00092431 predicted 328
8 SASI_Rn01_00092432 predicted 360
9 SASI_Rn01_00092433 predicted 204
10 SASI_Rn01_00092434 predicted 354
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019728 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00131537 predicted 193
2 SASI_Mm01_00131538 predicted 88
3 SASI_Mm02_00324867 predicted 261
4 SASI_Mm01_00131540 predicted 76
5 SASI_Mm01_00131541 predicted 77
6 SASI_Mm01_00131542 predicted 82
7 SASI_Mm01_00131543 predicted 101
8 SASI_Mm01_00131545 predicted 296
9 SASI_Mm01_00131546 predicted 202
10 SASI_Mm02_00324868 predicted 194
11 SASI_Mm01_00131539 predicted 270
12 SASI_Mm01_00131544 predicted 239
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019728
Defb4 MISSION shRNA Bacterial Glycerol Stock
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000077001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019728.2-110s1c1
Sequence:CCGGCCAATAACATGCATGACCAATCTCGAGATTGGTCATGCATGTTATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019728.2-93s1c1
Sequence:CCGGCCCAAATTATCAACAATCCAACTCGAGTTGGATTGTTGATAATTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019728.2-172s1c1
Sequence:CCGGGATTGGCAATTGTGGCCATTTCTCGAGAAATGGCCACAATTGCCAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076998    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019728.2-272s1c1
Sequence:CCGGCCATGAAGATTCACAAATCAACTCGAGTTGATTTGTGAATCTTCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019728.2-199s1c1
Sequence:CCGGCAGATGCTGTAAGATAAGATACTCGAGTATCTTATCTTACAGCATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019728
Defb4 MISSION shRNA shRNA Plasmid DNA
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000077001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019728.2-110s1c1
Sequence:CCGGCCAATAACATGCATGACCAATCTCGAGATTGGTCATGCATGTTATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019728.2-93s1c1
Sequence:CCGGCCCAAATTATCAACAATCCAACTCGAGTTGGATTGTTGATAATTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019728.2-172s1c1
Sequence:CCGGGATTGGCAATTGTGGCCATTTCTCGAGAAATGGCCACAATTGCCAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076998    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019728.2-272s1c1
Sequence:CCGGCCATGAAGATTCACAAATCAACTCGAGTTGATTTGTGAATCTTCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019728.2-199s1c1
Sequence:CCGGCAGATGCTGTAAGATAAGATACTCGAGTATCTTATCTTACAGCATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019728
Defb4 MISSION shRNA Lentiviral Transduction Particles
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000077001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019728.2-110s1c1
Sequence:CCGGCCAATAACATGCATGACCAATCTCGAGATTGGTCATGCATGTTATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019728.2-93s1c1
Sequence:CCGGCCCAAATTATCAACAATCCAACTCGAGTTGGATTGTTGATAATTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019728.2-172s1c1
Sequence:CCGGGATTGGCAATTGTGGCCATTTCTCGAGAAATGGCCACAATTGCCAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076998    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019728.2-272s1c1
Sequence:CCGGCCATGAAGATTCACAAATCAACTCGAGTTGATTTGTGAATCTTCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019728.2-199s1c1
Sequence:CCGGCAGATGCTGTAAGATAAGATACTCGAGTATCTTATCTTACAGCATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)