EMAIL THIS PAGE TO A FRIEND

DENND4A

DENN/MADD domain containing 4A

109 Gene Product Result for
Synonyms: IRLB MYCPBP
UniProtKB ID: Q7Z401, E7EPL3, Q14655, Q86T77, Q8IVX2, Q8NB93
Gene ID:
Mouse(102442) DENN/MADD domain containing 4A
Zebrafish(558211) DENN/MADD domain containing 4A
chicken(415541) DENN/MADD domain containing 4A
dog(487608) DENN/MADD domain containing 4A
domestic cat(101082661) DENN/MADD domain containing 4A
Horse(100053090) DENN/MADD domain containing 4A
cow(514906) DENN/MADD domain containing 4A
domestic guinea pig(100713717) DENN/MADD domain containing 4A
naked mole-rat(101719177) DENN/MADD domain containing 4A
sheep(101122440) DENN/MADD domain containing 4A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001162917 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001162917 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001162917 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005848 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005848 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005848 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005848 Rosetta Predictions human pricing
XM_001476259 Rosetta Predictions mouse pricing
XM_001480590 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005848 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00147702 predicted 5057
2 SASI_Hs02_00340392 predicted 327
3 SASI_Hs01_00147703 predicted 2008
4 SASI_Hs01_00147705 predicted 534
5 SASI_Hs02_00340393 predicted 1427
6 SASI_Hs01_00147706 predicted 5380
7 SASI_Hs01_00147707 predicted 2507
8 SASI_Hs02_00340394 predicted 3177
9 SASI_Hs01_00147709 predicted 4350
10 SASI_Hs01_00147710 predicted 2071
11 SASI_Hs01_00147704 predicted 4539
12 SASI_Hs01_00147708 predicted 4161
13 SASI_Hs01_00147711 predicted 4637
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001476259 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00387905 predicted 2083
2 SASI_Mm02_00387906 predicted 4001
3 SASI_Mm02_00387907 predicted 3866
4 SASI_Mm02_00387908 predicted 2575
5 SASI_Mm02_00387909 predicted 4121
6 SASI_Mm02_00387910 predicted 3414
7 SASI_Mm02_00387911 predicted 5040
8 SASI_Mm02_00387912 predicted 3816
9 SASI_Mm02_00387913 predicted 6153
10 SASI_Mm02_00387914 predicted 2801
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001480590 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00418617 predicted 2025
2 SASI_Mm02_00418618 predicted 3938
3 SASI_Mm02_00418619 predicted 3815
4 SASI_Mm02_00418620 predicted 2517
5 SASI_Mm02_00418621 predicted 4068
6 SASI_Mm02_00418622 predicted 3358
7 SASI_Mm02_00418623 predicted 4982
8 SASI_Mm02_00418624 predicted 3753
9 SASI_Mm02_00418625 predicted 6094
10 SASI_Mm02_00418626 predicted 2751
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001162917
DENND4A MISSION shRNA Bacterial Glycerol Stock
DENN/MADD domain containing 4A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000341380    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001162917.1-6475s21c1
Sequence:CCGGTTCGCCATGAAGTTCTATTATCTCGAGATAATAGAACTTCATGGCGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162917.1-847s21c1
Sequence:CCGGATGGACGACCTGCCAATATTACTCGAGTAATATTGGCAGGTCGTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162917.1-3009s21c1
Sequence:CCGGGCAATCACTTATGGATATTATCTCGAGATAATATCCATAAGTGATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162917.1-3182s21c1
Sequence:CCGGCCGGTCTGATCTTGGATATAACTCGAGTTATATCCAAGATCAGACCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162917.1-1044s21c1
Sequence:CCGGGCGGTATACTTATGCTATAAACTCGAGTTTATAGCATAAGTATACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001162917
DENND4A MISSION shRNA shRNA Plasmid DNA
DENN/MADD domain containing 4A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000341380    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001162917.1-6475s21c1
Sequence:CCGGTTCGCCATGAAGTTCTATTATCTCGAGATAATAGAACTTCATGGCGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162917.1-847s21c1
Sequence:CCGGATGGACGACCTGCCAATATTACTCGAGTAATATTGGCAGGTCGTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162917.1-3009s21c1
Sequence:CCGGGCAATCACTTATGGATATTATCTCGAGATAATATCCATAAGTGATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162917.1-3182s21c1
Sequence:CCGGCCGGTCTGATCTTGGATATAACTCGAGTTATATCCAAGATCAGACCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162917.1-1044s21c1
Sequence:CCGGGCGGTATACTTATGCTATAAACTCGAGTTTATAGCATAAGTATACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001162917
DENND4A MISSION shRNA Lentiviral Transduction Particles
DENN/MADD domain containing 4A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000341380    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001162917.1-6475s21c1
Sequence:CCGGTTCGCCATGAAGTTCTATTATCTCGAGATAATAGAACTTCATGGCGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162917.1-847s21c1
Sequence:CCGGATGGACGACCTGCCAATATTACTCGAGTAATATTGGCAGGTCGTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162917.1-3009s21c1
Sequence:CCGGGCAATCACTTATGGATATTATCTCGAGATAATATCCATAAGTGATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162917.1-3182s21c1
Sequence:CCGGCCGGTCTGATCTTGGATATAACTCGAGTTATATCCAAGATCAGACCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162917.1-1044s21c1
Sequence:CCGGGCGGTATACTTATGCTATAAACTCGAGTTTATAGCATAAGTATACCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005848
VALIDATED
DENND4A MISSION shRNA Bacterial Glycerol Stock
DENN/MADD domain containing 4A
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000153442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005848.1-4245s1c1
Sequence:CCGGCCCACTCATCACCTTCATTTACTCGAGTAAATGAAGGTGATGAGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150539    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005848.1-6116s1c1
Sequence:CCGGGAAAGCCACTTTGTTTCTCATCTCGAGATGAGAAACAAAGTGGCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151534    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_005848.1-6302s1c1
Sequence:CCGGCAGATGAACGTATTTCCTGTTCTCGAGAACAGGAAATACGTTCATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005848.1-4020s1c1
Sequence:CCGGGCATTGATTTACAACGGGCATCTCGAGATGCCCGTTGTAAATCAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152899    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005848.1-3045s1c1
Sequence:CCGGGCCAGTCTGATCTTGGATATACTCGAGTATATCCAAGATCAGACTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_005848.1-2539s1c1
Sequence:CCGGGCCCATGTTCAGAAGAACAAACTCGAGTTTGTTCTTCTGAACATGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_005848.1-5545s1c1
Sequence:CCGGGCCCTTGTACATTCTCTGGAACTCGAGTTCCAGAGAATGTACAAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005848
VALIDATED
DENND4A MISSION shRNA shRNA Plasmid DNA
DENN/MADD domain containing 4A
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000153442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005848.1-4245s1c1
Sequence:CCGGCCCACTCATCACCTTCATTTACTCGAGTAAATGAAGGTGATGAGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150539    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005848.1-6116s1c1
Sequence:CCGGGAAAGCCACTTTGTTTCTCATCTCGAGATGAGAAACAAAGTGGCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151534    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_005848.1-6302s1c1
Sequence:CCGGCAGATGAACGTATTTCCTGTTCTCGAGAACAGGAAATACGTTCATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005848.1-4020s1c1
Sequence:CCGGGCATTGATTTACAACGGGCATCTCGAGATGCCCGTTGTAAATCAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152899    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005848.1-3045s1c1
Sequence:CCGGGCCAGTCTGATCTTGGATATACTCGAGTATATCCAAGATCAGACTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_005848.1-2539s1c1
Sequence:CCGGGCCCATGTTCAGAAGAACAAACTCGAGTTTGTTCTTCTGAACATGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_005848.1-5545s1c1
Sequence:CCGGGCCCTTGTACATTCTCTGGAACTCGAGTTCCAGAGAATGTACAAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005848
VALIDATED
DENND4A MISSION shRNA Lentiviral Transduction Particles
DENN/MADD domain containing 4A
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000153442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005848.1-4245s1c1
Sequence:CCGGCCCACTCATCACCTTCATTTACTCGAGTAAATGAAGGTGATGAGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150539    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005848.1-6116s1c1
Sequence:CCGGGAAAGCCACTTTGTTTCTCATCTCGAGATGAGAAACAAAGTGGCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151534    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_005848.1-6302s1c1
Sequence:CCGGCAGATGAACGTATTTCCTGTTCTCGAGAACAGGAAATACGTTCATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005848.1-4020s1c1
Sequence:CCGGGCATTGATTTACAACGGGCATCTCGAGATGCCCGTTGTAAATCAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152899    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005848.1-3045s1c1
Sequence:CCGGGCCAGTCTGATCTTGGATATACTCGAGTATATCCAAGATCAGACTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_005848.1-2539s1c1
Sequence:CCGGGCCCATGTTCAGAAGAACAAACTCGAGTTTGTTCTTCTGAACATGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_005848.1-5545s1c1
Sequence:CCGGGCCCTTGTACATTCTCTGGAACTCGAGTTCCAGAGAATGTACAAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)