EMAIL THIS PAGE TO A FRIEND

DHRS13

dehydrogenase/reductase (SDR family) member 13

62 Gene Product Result for
Synonyms: SDR7C5
UniProtKB ID: Q6UX07, Q96BH7
Gene ID:
Mouse(70451) dehydrogenase/reductase (SDR family) member 13
sheep(101121023) dehydrogenase/reductase (SDR family) member 13
naked mole-rat(101720929) dehydrogenase/reductase (SDR family) member 13
domestic guinea pig(100721061) dehydrogenase/reductase (SDR family) member 13
chicken(100858939) dehydrogenase/reductase (SDR family) member 13
cow(514903) dehydrogenase/reductase (SDR family) member 13
domestic cat(101084583) dehydrogenase/reductase (SDR family) member 13
dog(491173) dehydrogenase/reductase (SDR family) member 13
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144683 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144683 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144683 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_183286 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183286 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183286 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144683 Rosetta Predictions human pricing
NM_183286 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144683 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00146276 predicted 718
2 SASI_Hs02_00364584 predicted 251
3 SASI_Hs01_00146279 predicted 713
4 SASI_Hs01_00146280 predicted 466
5 SASI_Hs01_00146281 predicted 372
6 SASI_Hs01_00146282 predicted 825
7 SASI_Hs02_00364585 predicted 250
8 SASI_Hs01_00146283 predicted 376
9 SASI_Hs01_00146285 predicted 459
10 SASI_Hs02_00364586 predicted 543
11 SASI_Hs01_00146277 predicted 556
12 SASI_Hs01_00146278 predicted 706
13 SASI_Hs01_00146284 predicted 803
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183286 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00350384 predicted 1388
2 SASI_Mm01_00064771 predicted 1271
3 SASI_Mm01_00064772 predicted 937
4 SASI_Mm02_00350385 predicted 288
5 SASI_Mm02_00350386 predicted 1164
6 SASI_Mm01_00064773 predicted 1126
7 SASI_Mm01_00064775 predicted 1261
8 SASI_Mm01_00064776 predicted 305
9 SASI_Mm02_00350387 predicted 1379
10 SASI_Mm01_00064777 predicted 1166
11 SASI_Mm01_00064768 predicted 1094
12 SASI_Mm01_00064769 predicted 927
13 SASI_Mm01_00064770 predicted 1148
14 SASI_Mm01_00064774 predicted 1126
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144683
DHRS13 MISSION shRNA Bacterial Glycerol Stock
dehydrogenase/reductase (SDR family) member 13
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144683.2-709s1c1
Sequence:CCGGGCTGACACTAAGCTGGCTAATCTCGAGATTAGCCAGCTTAGTGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144683.2-456s1c1
Sequence:CCGGGCCACGGTTGGACATCCTCATCTCGAGATGAGGATGTCCAACCGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144683.2-1146s1c1
Sequence:CCGGGCCCACAGTTTCTCAACCTTACTCGAGTAAGGTTGAGAAACTGTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144683.2-538s1c1
Sequence:CCGGGTGAACCATATCGGTCCCTTTCTCGAGAAAGGGACCGATATGGTTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144683.2-1182s1c1
Sequence:CCGGCTCACCAGATTTGTCTAAGATCTCGAGATCTTAGACAAATCTGGTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372040    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144683.3-1660s21c1
Sequence:CCGGCATGTTAATGAAGCGGAATTACTCGAGTAATTCCGCTTCATTAACATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144683.3-170s21c1
Sequence:CCGGTACGTGCTTGTCTACTACAACCTCGAGGTTGTAGTAGACAAGCACGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372042    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144683.3-1631s21c1
Sequence:CCGGACCGTCTAGCTAGGTAGTTAACTCGAGTTAACTACCTAGCTAGACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144683
DHRS13 MISSION shRNA shRNA Plasmid DNA
dehydrogenase/reductase (SDR family) member 13
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144683.2-709s1c1
Sequence:CCGGGCTGACACTAAGCTGGCTAATCTCGAGATTAGCCAGCTTAGTGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144683.2-456s1c1
Sequence:CCGGGCCACGGTTGGACATCCTCATCTCGAGATGAGGATGTCCAACCGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144683.2-1146s1c1
Sequence:CCGGGCCCACAGTTTCTCAACCTTACTCGAGTAAGGTTGAGAAACTGTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144683.2-538s1c1
Sequence:CCGGGTGAACCATATCGGTCCCTTTCTCGAGAAAGGGACCGATATGGTTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144683.2-1182s1c1
Sequence:CCGGCTCACCAGATTTGTCTAAGATCTCGAGATCTTAGACAAATCTGGTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372040    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144683.3-1660s21c1
Sequence:CCGGCATGTTAATGAAGCGGAATTACTCGAGTAATTCCGCTTCATTAACATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144683.3-170s21c1
Sequence:CCGGTACGTGCTTGTCTACTACAACCTCGAGGTTGTAGTAGACAAGCACGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372042    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144683.3-1631s21c1
Sequence:CCGGACCGTCTAGCTAGGTAGTTAACTCGAGTTAACTACCTAGCTAGACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144683
DHRS13 MISSION shRNA Lentiviral Transduction Particles
dehydrogenase/reductase (SDR family) member 13
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144683.2-709s1c1
Sequence:CCGGGCTGACACTAAGCTGGCTAATCTCGAGATTAGCCAGCTTAGTGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144683.2-456s1c1
Sequence:CCGGGCCACGGTTGGACATCCTCATCTCGAGATGAGGATGTCCAACCGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144683.2-1146s1c1
Sequence:CCGGGCCCACAGTTTCTCAACCTTACTCGAGTAAGGTTGAGAAACTGTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144683.2-538s1c1
Sequence:CCGGGTGAACCATATCGGTCCCTTTCTCGAGAAAGGGACCGATATGGTTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144683.2-1182s1c1
Sequence:CCGGCTCACCAGATTTGTCTAAGATCTCGAGATCTTAGACAAATCTGGTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372040    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144683.3-1660s21c1
Sequence:CCGGCATGTTAATGAAGCGGAATTACTCGAGTAATTCCGCTTCATTAACATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144683.3-170s21c1
Sequence:CCGGTACGTGCTTGTCTACTACAACCTCGAGGTTGTAGTAGACAAGCACGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372042    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144683.3-1631s21c1
Sequence:CCGGACCGTCTAGCTAGGTAGTTAACTCGAGTTAACTACCTAGCTAGACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183286
VALIDATED
DHRS13 MISSION shRNA Bacterial Glycerol Stock
dehydrogenase/reductase (SDR family) member 13
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201471    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_183286.1-1340s1c1
Sequence:CCGGCCCAGATTCAGGGATGATATACTCGAGTATATCATCCCTGAATCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217748    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183286.2-1173s1c1
Sequence:CCGGGATGAACCTACACCCTAACTTCTCGAGAAGTTAGGGTGTAGGTTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183286.2-446s21c1
Sequence:CCGGCCGGACTCGGGAAACCTTTAACTCGAGTTAAAGGTTTCCCGAGTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183286.2-1126s21c1
Sequence:CCGGGCTCGCAAGACTTATCCAAATCTCGAGATTTGGATAAGTCTTGCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183286.2-778s21c1
Sequence:CCGGCTGGATGGCTGCGTCCTATTTCTCGAGAAATAGGACGCAGCCATCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183286.2-1175s21c1
Sequence:CCGGTGAACCTACACCCTAACTTTCCTCGAGGAAAGTTAGGGTGTAGGTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183286
VALIDATED
DHRS13 MISSION shRNA shRNA Plasmid DNA
dehydrogenase/reductase (SDR family) member 13
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201471    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_183286.1-1340s1c1
Sequence:CCGGCCCAGATTCAGGGATGATATACTCGAGTATATCATCCCTGAATCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217748    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183286.2-1173s1c1
Sequence:CCGGGATGAACCTACACCCTAACTTCTCGAGAAGTTAGGGTGTAGGTTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183286.2-446s21c1
Sequence:CCGGCCGGACTCGGGAAACCTTTAACTCGAGTTAAAGGTTTCCCGAGTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183286.2-1126s21c1
Sequence:CCGGGCTCGCAAGACTTATCCAAATCTCGAGATTTGGATAAGTCTTGCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183286.2-778s21c1
Sequence:CCGGCTGGATGGCTGCGTCCTATTTCTCGAGAAATAGGACGCAGCCATCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183286.2-1175s21c1
Sequence:CCGGTGAACCTACACCCTAACTTTCCTCGAGGAAAGTTAGGGTGTAGGTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183286
VALIDATED
DHRS13 MISSION shRNA Lentiviral Transduction Particles
dehydrogenase/reductase (SDR family) member 13
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201471    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_183286.1-1340s1c1
Sequence:CCGGCCCAGATTCAGGGATGATATACTCGAGTATATCATCCCTGAATCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217748    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183286.2-1173s1c1
Sequence:CCGGGATGAACCTACACCCTAACTTCTCGAGAAGTTAGGGTGTAGGTTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183286.2-446s21c1
Sequence:CCGGCCGGACTCGGGAAACCTTTAACTCGAGTTAAAGGTTTCCCGAGTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183286.2-1126s21c1
Sequence:CCGGGCTCGCAAGACTTATCCAAATCTCGAGATTTGGATAAGTCTTGCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183286.2-778s21c1
Sequence:CCGGCTGGATGGCTGCGTCCTATTTCTCGAGAAATAGGACGCAGCCATCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183286.2-1175s21c1
Sequence:CCGGTGAACCTACACCCTAACTTTCCTCGAGGAAAGTTAGGGTGTAGGTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)