EMAIL THIS PAGE TO A FRIEND

DHRS7

dehydrogenase/reductase (SDR family) member 7

48 Gene Product Result for
Synonyms: SDR34C1 retDSR4 retSDR4
UniProtKB ID: Q9Y394, B2R896, Q9UKU2
Gene ID:
Human(51635) Summary: Short-chain dehydrogenases/reductases (SDRs), such as DHRS7, catalyze the oxidation/reduction of a wide range of substrates, including retinoids and steroids (Haeseleer and Palczewski, 2000 [PubMed 10800688]
Mouse(66375) dehydrogenase/reductase (SDR family) member 7
Rat(299131) dehydrogenase/reductase (SDR family) member 7
Zebrafish(751626) dehydrogenase/reductase (SDR family) member 7
domestic cat(101101227) dehydrogenase/reductase (SDR family) member 7
cow(514044) dehydrogenase/reductase (SDR family) member 7
chicken(423527) dehydrogenase/reductase (SDR family) member 7
dog(480342) dehydrogenase/reductase (SDR family) member 7
sheep(101103158) dehydrogenase/reductase (SDR family) member 7
naked mole-rat(101721892) dehydrogenase/reductase (SDR family) member 7
domestic guinea pig(100734266) dehydrogenase/reductase (SDR family) member 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016029 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016029 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016029 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025522 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025522 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025522 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU163231 MISSION® esiRNA esiRNA targeting mouse Dhrs7 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016029 Rosetta Predictions human pricing
NM_001013098 Rosetta Predictions rat pricing
NM_025522 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016029 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00029368 predicted 616
2 SASI_Hs01_00029369 predicted 541
3 SASI_Hs01_00029370 predicted 872
4 SASI_Hs01_00029371 predicted 934
5 SASI_Hs01_00029372 predicted 541
6 SASI_Hs01_00029373 predicted 819
7 SASI_Hs01_00029375 predicted 351
8 SASI_Hs01_00029376 predicted 546
9 SASI_Hs01_00029377 predicted 519
10 SASI_Hs02_00348735 predicted 918
11 SASI_Hs01_00029374 predicted 757
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013098 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00084600 predicted 1054
2 SASI_Rn01_00084606 predicted 1064
3 SASI_Rn01_00084607 predicted 778
4 SASI_Rn01_00084601 predicted 972
5 SASI_Rn01_00084602 predicted 1027
6 SASI_Rn01_00084603 predicted 882
7 SASI_Rn01_00084604 predicted 1124
8 SASI_Rn01_00084605 predicted 989
9 SASI_Rn01_00084608 predicted 884
10 SASI_Rn01_00084609 predicted 651
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025522 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00138369 predicted 750
2 SASI_Mm01_00138371 predicted 387
3 SASI_Mm01_00138372 predicted 206
4 SASI_Mm01_00138373 predicted 377
5 SASI_Mm01_00138374 predicted 723
6 SASI_Mm01_00138375 predicted 899
7 SASI_Mm02_00328428 predicted 596
8 SASI_Mm01_00138376 predicted 740
9 SASI_Mm01_00138377 predicted 670
10 SASI_Mm01_00138378 predicted 821
11 SASI_Mm01_00138370 predicted 597
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016029
VALIDATED
DHRS7 MISSION shRNA Bacterial Glycerol Stock
dehydrogenase/reductase (SDR family) member 7
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016029.1-358s1c1
Sequence:CCGGGCCTAGAGAATGGCAATTTAACTCGAGTTAAATTGCCATTCTCTAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_016029.1-909s1c1
Sequence:CCGGGCCAATGATTTGAAAGAAGTTCTCGAGAACTTCTTTCAAATCATTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016029.1-887s1c1
Sequence:CCGGGCGGCTGATGTTAATCAGCATCTCGAGATGCTGATTAACATCAGCCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016029.1-749s1c1
Sequence:CCGGCCCAGGTATAATAGTTTCTAACTCGAGTTAGAAACTATTATACCTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_016029.1-276s1c1
Sequence:CCGGGCTTACCAGTTGTCTAAACTACTCGAGTAGTTTAGACAACTGGTAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016029.2-994s21c1
Sequence:CCGGGCGGCTGATGTTAATCAGCATCTCGAGATGCTGATTAACATCAGCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016029.2-856s21c1
Sequence:CCGGCCCAGGTATAATAGTTTCTAACTCGAGTTAGAAACTATTATACCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016029.2-465s21c1
Sequence:CCGGGCCTAGAGAATGGCAATTTAACTCGAGTTAAATTGCCATTCTCTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016029.2-1016s21c1
Sequence:CCGGGCCAATGATTTGAAAGAAGTTCTCGAGAACTTCTTTCAAATCATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016029.2-383s21c1
Sequence:CCGGGCTTACCAGTTGTCTAAACTACTCGAGTAGTTTAGACAACTGGTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016029
VALIDATED
DHRS7 MISSION shRNA shRNA Plasmid DNA
dehydrogenase/reductase (SDR family) member 7
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016029.1-358s1c1
Sequence:CCGGGCCTAGAGAATGGCAATTTAACTCGAGTTAAATTGCCATTCTCTAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_016029.1-909s1c1
Sequence:CCGGGCCAATGATTTGAAAGAAGTTCTCGAGAACTTCTTTCAAATCATTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016029.1-887s1c1
Sequence:CCGGGCGGCTGATGTTAATCAGCATCTCGAGATGCTGATTAACATCAGCCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016029.1-749s1c1
Sequence:CCGGCCCAGGTATAATAGTTTCTAACTCGAGTTAGAAACTATTATACCTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_016029.1-276s1c1
Sequence:CCGGGCTTACCAGTTGTCTAAACTACTCGAGTAGTTTAGACAACTGGTAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016029.2-994s21c1
Sequence:CCGGGCGGCTGATGTTAATCAGCATCTCGAGATGCTGATTAACATCAGCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016029.2-856s21c1
Sequence:CCGGCCCAGGTATAATAGTTTCTAACTCGAGTTAGAAACTATTATACCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016029.2-465s21c1
Sequence:CCGGGCCTAGAGAATGGCAATTTAACTCGAGTTAAATTGCCATTCTCTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016029.2-1016s21c1
Sequence:CCGGGCCAATGATTTGAAAGAAGTTCTCGAGAACTTCTTTCAAATCATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016029.2-383s21c1
Sequence:CCGGGCTTACCAGTTGTCTAAACTACTCGAGTAGTTTAGACAACTGGTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016029
VALIDATED
DHRS7 MISSION shRNA Lentiviral Transduction Particles
dehydrogenase/reductase (SDR family) member 7
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016029.1-358s1c1
Sequence:CCGGGCCTAGAGAATGGCAATTTAACTCGAGTTAAATTGCCATTCTCTAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_016029.1-909s1c1
Sequence:CCGGGCCAATGATTTGAAAGAAGTTCTCGAGAACTTCTTTCAAATCATTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016029.1-887s1c1
Sequence:CCGGGCGGCTGATGTTAATCAGCATCTCGAGATGCTGATTAACATCAGCCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016029.1-749s1c1
Sequence:CCGGCCCAGGTATAATAGTTTCTAACTCGAGTTAGAAACTATTATACCTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_016029.1-276s1c1
Sequence:CCGGGCTTACCAGTTGTCTAAACTACTCGAGTAGTTTAGACAACTGGTAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016029.2-994s21c1
Sequence:CCGGGCGGCTGATGTTAATCAGCATCTCGAGATGCTGATTAACATCAGCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016029.2-856s21c1
Sequence:CCGGCCCAGGTATAATAGTTTCTAACTCGAGTTAGAAACTATTATACCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016029.2-465s21c1
Sequence:CCGGGCCTAGAGAATGGCAATTTAACTCGAGTTAAATTGCCATTCTCTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016029.2-1016s21c1
Sequence:CCGGGCCAATGATTTGAAAGAAGTTCTCGAGAACTTCTTTCAAATCATTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016029.2-383s21c1
Sequence:CCGGGCTTACCAGTTGTCTAAACTACTCGAGTAGTTTAGACAACTGGTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025522
VALIDATED
DHRS7 MISSION shRNA Bacterial Glycerol Stock
dehydrogenase/reductase (SDR family) member 7
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025522.1-762s1c1
Sequence:CCGGCCGAGGAAGTAACTAAGTCTACTCGAGTAGACTTAGTTACTTCCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025522.1-937s1c1
Sequence:CCGGCGCATGGCTAAACTGCAAGTTCTCGAGAACTTGCAGTTTAGCCATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025522.1-493s1c1
Sequence:CCGGGCTGATAAATCTGAACTACATCTCGAGATGTAGTTCAGATTTATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025522.1-218s1c1
Sequence:CCGGCTAGCTTTCCAGTTATCTAAACTCGAGTTTAGATAACTGGAAAGCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025522.1-348s1c1
Sequence:CCGGCCCTTGACTTGACCGATACAACTCGAGTTGTATCGGTCAAGTCAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025522.5-393s21c1
Sequence:CCGGCCCTTGACTTGACCGATACAACTCGAGTTGTATCGGTCAAGTCAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025522.5-982s21c1
Sequence:CCGGCGCATGGCTAAACTGCAAGTTCTCGAGAACTTGCAGTTTAGCCATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025522.5-263s21c1
Sequence:CCGGCTAGCTTTCCAGTTATCTAAACTCGAGTTTAGATAACTGGAAAGCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025522.5-538s21c1
Sequence:CCGGGCTGATAAATCTGAACTACATCTCGAGATGTAGTTCAGATTTATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025522.5-807s21c1
Sequence:CCGGCCGAGGAAGTAACTAAGTCTACTCGAGTAGACTTAGTTACTTCCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025522
VALIDATED
DHRS7 MISSION shRNA shRNA Plasmid DNA
dehydrogenase/reductase (SDR family) member 7
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025522.1-762s1c1
Sequence:CCGGCCGAGGAAGTAACTAAGTCTACTCGAGTAGACTTAGTTACTTCCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025522.1-937s1c1
Sequence:CCGGCGCATGGCTAAACTGCAAGTTCTCGAGAACTTGCAGTTTAGCCATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025522.1-493s1c1
Sequence:CCGGGCTGATAAATCTGAACTACATCTCGAGATGTAGTTCAGATTTATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025522.1-218s1c1
Sequence:CCGGCTAGCTTTCCAGTTATCTAAACTCGAGTTTAGATAACTGGAAAGCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025522.1-348s1c1
Sequence:CCGGCCCTTGACTTGACCGATACAACTCGAGTTGTATCGGTCAAGTCAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025522.5-393s21c1
Sequence:CCGGCCCTTGACTTGACCGATACAACTCGAGTTGTATCGGTCAAGTCAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025522.5-982s21c1
Sequence:CCGGCGCATGGCTAAACTGCAAGTTCTCGAGAACTTGCAGTTTAGCCATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025522.5-263s21c1
Sequence:CCGGCTAGCTTTCCAGTTATCTAAACTCGAGTTTAGATAACTGGAAAGCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025522.5-538s21c1
Sequence:CCGGGCTGATAAATCTGAACTACATCTCGAGATGTAGTTCAGATTTATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025522.5-807s21c1
Sequence:CCGGCCGAGGAAGTAACTAAGTCTACTCGAGTAGACTTAGTTACTTCCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025522
VALIDATED
DHRS7 MISSION shRNA Lentiviral Transduction Particles
dehydrogenase/reductase (SDR family) member 7
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025522.1-762s1c1
Sequence:CCGGCCGAGGAAGTAACTAAGTCTACTCGAGTAGACTTAGTTACTTCCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025522.1-937s1c1
Sequence:CCGGCGCATGGCTAAACTGCAAGTTCTCGAGAACTTGCAGTTTAGCCATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025522.1-493s1c1
Sequence:CCGGGCTGATAAATCTGAACTACATCTCGAGATGTAGTTCAGATTTATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025522.1-218s1c1
Sequence:CCGGCTAGCTTTCCAGTTATCTAAACTCGAGTTTAGATAACTGGAAAGCTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025522.1-348s1c1
Sequence:CCGGCCCTTGACTTGACCGATACAACTCGAGTTGTATCGGTCAAGTCAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025522.5-393s21c1
Sequence:CCGGCCCTTGACTTGACCGATACAACTCGAGTTGTATCGGTCAAGTCAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025522.5-982s21c1
Sequence:CCGGCGCATGGCTAAACTGCAAGTTCTCGAGAACTTGCAGTTTAGCCATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025522.5-263s21c1
Sequence:CCGGCTAGCTTTCCAGTTATCTAAACTCGAGTTTAGATAACTGGAAAGCTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025522.5-538s21c1
Sequence:CCGGGCTGATAAATCTGAACTACATCTCGAGATGTAGTTCAGATTTATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025522.5-807s21c1
Sequence:CCGGCCGAGGAAGTAACTAAGTCTACTCGAGTAGACTTAGTTACTTCCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)