EMAIL THIS PAGE TO A FRIEND

DHX36

DEAH (Asp-Glu-Ala-His) box polypeptide 36

99 Gene Product Result for
Synonyms: DDX36 G4R1 MLEL1 RHAU
UniProtKB ID: Q9H2U1, B2RB00, Q70JU3, Q8IYE5, Q9P240
Gene ID:
Human(170506) Summary: This gene is a member of the DEAH-box family of RNA-dependent NTPases which are named after the conserved amino acid sequence Asp-Glu-Ala-His in motif II. The protein encoded by this gene has been shown to enhance the deadenylation and decay of mRNAs with 3'-UTR AU-rich elements (ARE-mRNA). The protein has also been shown to resolve into single strands the highly stable tetramolecular DNA configuration (G4) that can form spontaneously in guanine-rich regions of DNA. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(72162) DEAH (Asp-Glu-Ala-His) box polypeptide 36
Rat(310461) DEAH (Asp-Glu-Ala-His) box polypeptide 36
sheep(101113451) DEAH (Asp-Glu-Ala-His) box polypeptide 36
Domestic Rabbit(100355806) DEAH (Asp-Glu-Ala-His) box polypeptide 36
naked mole-rat(101714069) DEAH (Asp-Glu-Ala-His) box polypeptide 36
domestic guinea pig(100725329) DEAH (Asp-Glu-Ala-His) box polypeptide 36
chicken(425032) DEAH (Asp-Glu-Ala-His) box polypeptide 36
cow(509583) DEAH (Asp-Glu-Ala-His) box polypeptide 36
domestic cat(101089541) DEAH (Asp-Glu-Ala-His) box polypeptide 36
dog(477117) DEAH (Asp-Glu-Ala-His) box polypeptide 36
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020865 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020865 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020865 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028136 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028136 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028136 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU083701 MISSION® esiRNA esiRNA human DHX36 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001114397 Rosetta Predictions human pricing
NM_020865 Rosetta Predictions human pricing
NM_001107678 Rosetta Predictions rat pricing
NM_028136 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114397 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326614 predicted 2972
2 SASI_Hs02_00326615 predicted 1308
3 SASI_Hs02_00326616 predicted 2894
4 SASI_Hs02_00326617 predicted 2205
5 SASI_Hs02_00326618 predicted 253
6 SASI_Hs02_00326619 predicted 1066
7 SASI_Hs02_00326620 predicted 868
8 SASI_Hs02_00326621 predicted 876
9 SASI_Hs02_00326622 predicted 1053
10 SASI_Hs02_00326623 predicted 1341
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020865 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226173 predicted 3018
2 SASI_Hs02_00354155 predicted 1316
3 SASI_Hs02_00354156 predicted 2931
4 SASI_Hs02_00354157 predicted 2248
5 SASI_Hs02_00354158 predicted 258
6 SASI_Hs02_00354159 predicted 1057
7 SASI_Hs01_00226176 predicted 871
8 SASI_Hs01_00226177 predicted 884
9 SASI_Hs01_00226178 predicted 1051
10 SASI_Hs01_00226181 predicted 1342
11 SASI_Hs01_00226172 predicted 1898
12 SASI_Hs01_00226174 predicted 1311
13 SASI_Hs01_00226175 predicted 2950
14 SASI_Hs01_00226179 predicted 1735
15 SASI_Hs01_00226180 predicted 1445
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107678 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231195 predicted 891
2 SASI_Rn02_00231196 predicted 768
3 SASI_Rn02_00231197 predicted 1029
4 SASI_Rn02_00231198 predicted 2693
5 SASI_Rn02_00231199 predicted 1198
6 SASI_Rn02_00231200 predicted 2543
7 SASI_Rn02_00231201 predicted 954
8 SASI_Rn02_00231202 predicted 839
9 SASI_Rn02_00231203 predicted 576
10 SASI_Rn02_00231204 predicted 1511
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028136 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00148330 predicted 873
2 SASI_Mm01_00148331 predicted 998
3 SASI_Mm01_00148332 predicted 2051
4 SASI_Mm02_00333405 predicted 1549
5 SASI_Mm01_00148333 predicted 2198
6 SASI_Mm01_00148334 predicted 683
7 SASI_Mm01_00148336 predicted 385
8 SASI_Mm01_00148337 predicted 1041
9 SASI_Mm02_00333406 predicted 1694
10 SASI_Mm01_00148339 predicted 1686
11 SASI_Mm01_00148335 predicted 2800
12 SASI_Mm01_00148338 predicted 1459
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020865
VALIDATED
DHX36 MISSION shRNA Bacterial Glycerol Stock
DEAH (Asp-Glu-Ala-His) box polypeptide 36
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020865.1-1563s1c1
Sequence:CCGGGCTGGGACAATATCAGCACTTCTCGAGAAGTGCTGATATTGTCCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020865.1-2582s1c1
Sequence:CCGGGCTGGTTTATATCCCAAAGTTCTCGAGAACTTTGGGATATAAACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_020865.1-341s1c1
Sequence:CCGGCGACGAGAAGAACAAATTGTACTCGAGTACAATTTGTTCTTCTCGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_020865.1-1142s1c1
Sequence:CCGGCGATCTGACTTGAAAGTAATACTCGAGTATTACTTTCAAGTCAGATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020865.1-3071s1c1
Sequence:CCGGCCACGATTCCAGGATGGATATCTCGAGATATCCATCCTGGAATCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_020865.2-1840s21c1
Sequence:CCGGTCCGCTGAGTGGGTTAGTAAACTCGAGTTTACTAACCCACTCAGCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_020865.2-1150s21c1
Sequence:CCGGCGATCTGACTTGAAAGTAATACTCGAGTATTACTTTCAAGTCAGATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_020865.2-349s21c1
Sequence:CCGGCGACGAGAAGAACAAATTGTACTCGAGTACAATTTGTTCTTCTCGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_020865.2-1757s21c1
Sequence:CCGGCCATAGATGATGTCGTTTATGCTCGAGCATAAACGACATCATCTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296512    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020865.2-3348s21c1
Sequence:CCGGCCCACTCTTTGGGAGTATATTCTCGAGAATATACTCCCAAAGAGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020865
VALIDATED
DHX36 MISSION shRNA shRNA Plasmid DNA
DEAH (Asp-Glu-Ala-His) box polypeptide 36
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020865.1-1563s1c1
Sequence:CCGGGCTGGGACAATATCAGCACTTCTCGAGAAGTGCTGATATTGTCCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020865.1-2582s1c1
Sequence:CCGGGCTGGTTTATATCCCAAAGTTCTCGAGAACTTTGGGATATAAACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_020865.1-341s1c1
Sequence:CCGGCGACGAGAAGAACAAATTGTACTCGAGTACAATTTGTTCTTCTCGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_020865.1-1142s1c1
Sequence:CCGGCGATCTGACTTGAAAGTAATACTCGAGTATTACTTTCAAGTCAGATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020865.1-3071s1c1
Sequence:CCGGCCACGATTCCAGGATGGATATCTCGAGATATCCATCCTGGAATCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_020865.2-1840s21c1
Sequence:CCGGTCCGCTGAGTGGGTTAGTAAACTCGAGTTTACTAACCCACTCAGCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_020865.2-1150s21c1
Sequence:CCGGCGATCTGACTTGAAAGTAATACTCGAGTATTACTTTCAAGTCAGATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_020865.2-349s21c1
Sequence:CCGGCGACGAGAAGAACAAATTGTACTCGAGTACAATTTGTTCTTCTCGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_020865.2-1757s21c1
Sequence:CCGGCCATAGATGATGTCGTTTATGCTCGAGCATAAACGACATCATCTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296512    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020865.2-3348s21c1
Sequence:CCGGCCCACTCTTTGGGAGTATATTCTCGAGAATATACTCCCAAAGAGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020865
VALIDATED
DHX36 MISSION shRNA Lentiviral Transduction Particles
DEAH (Asp-Glu-Ala-His) box polypeptide 36
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020865.1-1563s1c1
Sequence:CCGGGCTGGGACAATATCAGCACTTCTCGAGAAGTGCTGATATTGTCCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020865.1-2582s1c1
Sequence:CCGGGCTGGTTTATATCCCAAAGTTCTCGAGAACTTTGGGATATAAACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_020865.1-341s1c1
Sequence:CCGGCGACGAGAAGAACAAATTGTACTCGAGTACAATTTGTTCTTCTCGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_020865.1-1142s1c1
Sequence:CCGGCGATCTGACTTGAAAGTAATACTCGAGTATTACTTTCAAGTCAGATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020865.1-3071s1c1
Sequence:CCGGCCACGATTCCAGGATGGATATCTCGAGATATCCATCCTGGAATCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_020865.2-1840s21c1
Sequence:CCGGTCCGCTGAGTGGGTTAGTAAACTCGAGTTTACTAACCCACTCAGCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_020865.2-1150s21c1
Sequence:CCGGCGATCTGACTTGAAAGTAATACTCGAGTATTACTTTCAAGTCAGATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_020865.2-349s21c1
Sequence:CCGGCGACGAGAAGAACAAATTGTACTCGAGTACAATTTGTTCTTCTCGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_020865.2-1757s21c1
Sequence:CCGGCCATAGATGATGTCGTTTATGCTCGAGCATAAACGACATCATCTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296512    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020865.2-3348s21c1
Sequence:CCGGCCCACTCTTTGGGAGTATATTCTCGAGAATATACTCCCAAAGAGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028136
VALIDATED
DHX36 MISSION shRNA Bacterial Glycerol Stock
DEAH (Asp-Glu-Ala-His) box polypeptide 36
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028136.1-1454s1c1
Sequence:CCGGGCTGCCCTTATTCGATACATTCTCGAGAATGTATCGAATAAGGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028136.1-2623s1c1
Sequence:CCGGCCTGGTTTCTATTCATCCTAACTCGAGTTAGGATGAATAGAAACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028136.1-2856s1c1
Sequence:CCGGCCCATCTTGTTAAGGGACTAACTCGAGTTAGTCCCTTAACAAGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028136.1-818s1c1
Sequence:CCGGCCGAGAAGAATTAGTGCCATTCTCGAGAATGGCACTAATTCTTCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028136.1-1127s1c1
Sequence:CCGGGCAACTTTGAATGCTGAGAAACTCGAGTTTCTCAGCATTCAAAGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028136.2-3027s21c1
Sequence:CCGGCACGGTCACAGGACGGATATTCTCGAGAATATCCGTCCTGTGACCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028136.1-1620s21c1
Sequence:CCGGTCAACCAGACACAGGTATTTACTCGAGTAAATACCTGTGTCTGGTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348913    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028136.2-3487s21c1
Sequence:CCGGGTTGTAATAAAGTCCGATATTCTCGAGAATATCGGACTTTATTACAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028136.2-559s21c1
Sequence:CCGGCCTAAGCTTAGATCAACATTTCTCGAGAAATGTTGATCTAAGCTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312950    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028136.1-3221s21c1
Sequence:CCGGGTGCCATCTAGCTACTATAAACTCGAGTTTATAGTAGCTAGATGGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028136.1-2856s21c1
Sequence:CCGGCCCATCTTGTTAAGGGACTAACTCGAGTTAGTCCCTTAACAAGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028136.1-518s21c1
Sequence:CCGGGACCGAGATTCTGAGTATTTACTCGAGTAAATACTCAGAATCTCGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028136.1-3028s21c1
Sequence:CCGGACGGTCACAGGACGGATATTACTCGAGTAATATCCGTCCTGTGACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028136
VALIDATED
DHX36 MISSION shRNA shRNA Plasmid DNA
DEAH (Asp-Glu-Ala-His) box polypeptide 36
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028136.1-1454s1c1
Sequence:CCGGGCTGCCCTTATTCGATACATTCTCGAGAATGTATCGAATAAGGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028136.1-2623s1c1
Sequence:CCGGCCTGGTTTCTATTCATCCTAACTCGAGTTAGGATGAATAGAAACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028136.1-2856s1c1
Sequence:CCGGCCCATCTTGTTAAGGGACTAACTCGAGTTAGTCCCTTAACAAGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028136.1-818s1c1
Sequence:CCGGCCGAGAAGAATTAGTGCCATTCTCGAGAATGGCACTAATTCTTCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028136.1-1127s1c1
Sequence:CCGGGCAACTTTGAATGCTGAGAAACTCGAGTTTCTCAGCATTCAAAGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028136.2-3027s21c1
Sequence:CCGGCACGGTCACAGGACGGATATTCTCGAGAATATCCGTCCTGTGACCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028136.1-1620s21c1
Sequence:CCGGTCAACCAGACACAGGTATTTACTCGAGTAAATACCTGTGTCTGGTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348913    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028136.2-3487s21c1
Sequence:CCGGGTTGTAATAAAGTCCGATATTCTCGAGAATATCGGACTTTATTACAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028136.2-559s21c1
Sequence:CCGGCCTAAGCTTAGATCAACATTTCTCGAGAAATGTTGATCTAAGCTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312950    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028136.1-3221s21c1
Sequence:CCGGGTGCCATCTAGCTACTATAAACTCGAGTTTATAGTAGCTAGATGGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028136.1-2856s21c1
Sequence:CCGGCCCATCTTGTTAAGGGACTAACTCGAGTTAGTCCCTTAACAAGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028136.1-518s21c1
Sequence:CCGGGACCGAGATTCTGAGTATTTACTCGAGTAAATACTCAGAATCTCGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028136.1-3028s21c1
Sequence:CCGGACGGTCACAGGACGGATATTACTCGAGTAATATCCGTCCTGTGACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028136
VALIDATED
DHX36 MISSION shRNA Lentiviral Transduction Particles
DEAH (Asp-Glu-Ala-His) box polypeptide 36
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028136.1-1454s1c1
Sequence:CCGGGCTGCCCTTATTCGATACATTCTCGAGAATGTATCGAATAAGGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028136.1-2623s1c1
Sequence:CCGGCCTGGTTTCTATTCATCCTAACTCGAGTTAGGATGAATAGAAACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028136.1-2856s1c1
Sequence:CCGGCCCATCTTGTTAAGGGACTAACTCGAGTTAGTCCCTTAACAAGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028136.1-818s1c1
Sequence:CCGGCCGAGAAGAATTAGTGCCATTCTCGAGAATGGCACTAATTCTTCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028136.1-1127s1c1
Sequence:CCGGGCAACTTTGAATGCTGAGAAACTCGAGTTTCTCAGCATTCAAAGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028136.2-3027s21c1
Sequence:CCGGCACGGTCACAGGACGGATATTCTCGAGAATATCCGTCCTGTGACCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028136.1-1620s21c1
Sequence:CCGGTCAACCAGACACAGGTATTTACTCGAGTAAATACCTGTGTCTGGTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348913    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028136.2-3487s21c1
Sequence:CCGGGTTGTAATAAAGTCCGATATTCTCGAGAATATCGGACTTTATTACAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028136.2-559s21c1
Sequence:CCGGCCTAAGCTTAGATCAACATTTCTCGAGAAATGTTGATCTAAGCTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312950    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028136.1-3221s21c1
Sequence:CCGGGTGCCATCTAGCTACTATAAACTCGAGTTTATAGTAGCTAGATGGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028136.1-2856s21c1
Sequence:CCGGCCCATCTTGTTAAGGGACTAACTCGAGTTAGTCCCTTAACAAGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028136.1-518s21c1
Sequence:CCGGGACCGAGATTCTGAGTATTTACTCGAGTAAATACTCAGAATCTCGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028136.1-3028s21c1
Sequence:CCGGACGGTCACAGGACGGATATTACTCGAGTAATATCCGTCCTGTGACCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)