EMAIL THIS PAGE TO A FRIEND

DICER1-AS1

DICER1 antisense RNA 1

2 Gene Product Result for
Synonyms: DICER1-AS
Species: Human DICER1-AS1(400242)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207443 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207443 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207443 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207443
DICER1-AS1 MISSION shRNA Bacterial Glycerol Stock
DICER1 antisense RNA 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207443.1-652s1c1
Sequence:CCGGCAGGTTCAAGTGATTCTCCTACTCGAGTAGGAGAATCACTTGAACCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128714    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207443.1-1689s1c1
Sequence:CCGGCCTTGAGCTAAGGAGTTCAAACTCGAGTTTGAACTCCTTAGCTCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149766    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207443.1-455s1c1
Sequence:CCGGGAGTGCAGAGATGTCTTCAATCTCGAGATTGAAGACATCTCTGCACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146520    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207443.1-965s1c1
Sequence:CCGGCCATTCCTTATTGCCTGTCTTCTCGAGAAGACAGGCAATAAGGAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207443.1-414s1c1
Sequence:CCGGCCAAATCTTGGCTGTTGTGAACTCGAGTTCACAACAGCCAAGATTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207443.1-521s1c1
Sequence:CCGGCTGGATCATATGGTAGCTCTACTCGAGTAGAGCTACCATATGATCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207443
DICER1-AS1 MISSION shRNA shRNA Plasmid DNA
DICER1 antisense RNA 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207443.1-652s1c1
Sequence:CCGGCAGGTTCAAGTGATTCTCCTACTCGAGTAGGAGAATCACTTGAACCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128714    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207443.1-1689s1c1
Sequence:CCGGCCTTGAGCTAAGGAGTTCAAACTCGAGTTTGAACTCCTTAGCTCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149766    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207443.1-455s1c1
Sequence:CCGGGAGTGCAGAGATGTCTTCAATCTCGAGATTGAAGACATCTCTGCACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146520    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207443.1-965s1c1
Sequence:CCGGCCATTCCTTATTGCCTGTCTTCTCGAGAAGACAGGCAATAAGGAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207443.1-414s1c1
Sequence:CCGGCCAAATCTTGGCTGTTGTGAACTCGAGTTCACAACAGCCAAGATTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207443.1-521s1c1
Sequence:CCGGCTGGATCATATGGTAGCTCTACTCGAGTAGAGCTACCATATGATCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207443
DICER1-AS1 MISSION shRNA Lentiviral Transduction Particles
DICER1 antisense RNA 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207443.1-652s1c1
Sequence:CCGGCAGGTTCAAGTGATTCTCCTACTCGAGTAGGAGAATCACTTGAACCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128714    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207443.1-1689s1c1
Sequence:CCGGCCTTGAGCTAAGGAGTTCAAACTCGAGTTTGAACTCCTTAGCTCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149766    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207443.1-455s1c1
Sequence:CCGGGAGTGCAGAGATGTCTTCAATCTCGAGATTGAAGACATCTCTGCACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146520    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207443.1-965s1c1
Sequence:CCGGCCATTCCTTATTGCCTGTCTTCTCGAGAAGACAGGCAATAAGGAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207443.1-414s1c1
Sequence:CCGGCCAAATCTTGGCTGTTGTGAACTCGAGTTCACAACAGCCAAGATTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207443.1-521s1c1
Sequence:CCGGCTGGATCATATGGTAGCTCTACTCGAGTAGAGCTACCATATGATCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)