EMAIL THIS PAGE TO A FRIEND

DIP2C

DIP2 disco-interacting protein 2 homolog C (Drosophila)

166 Gene Product Result for
Synonyms: KIAA0934
UniProtKB ID: Q9Y2E4, Q5SS78
Gene ID:
Human(22982) Summary: This gene encodes a member of the disco-interacting protein homolog 2 family. The protein shares strong similarity with a Drosophila protein which interacts with the transcription factor disco and is expressed in the nervous system. [provided by RefSeq, Oct 2008]
Mouse(208440) DIP2 disco-interacting protein 2 homolog C (Drosophila)
Rat(307067) DIP2 disco-interacting protein 2 homolog C (Drosophila)
Zebrafish(563890) DIP2 disco-interacting protein 2 homolog C (Drosophila)
chicken(420456) DIP2 disco-interacting protein 2 homolog C (Drosophila)
domestic cat(101094271) DIP2 disco-interacting protein 2 homolog C (Drosophila)
Horse(100071284) DIP2 disco-interacting protein 2 homolog C (Drosophila)
dog(610591) DIP2 disco-interacting protein 2 homolog C (Drosophila)
cow(535136) DIP2 disco-interacting protein 2 homolog C (Drosophila)
sheep(101109113) DIP2 disco-interacting protein 2 homolog C (Drosophila)
domestic guinea pig(100732399) DIP2 disco-interacting protein 2 homolog C (Drosophila)
naked mole-rat(101715380) DIP2 disco-interacting protein 2 homolog C (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014974 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014974 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014974 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081426 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081426 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081426 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014974 Rosetta Predictions human pricing
NM_001107360 Rosetta Predictions rat pricing
NM_001081426 Rosetta Predictions mouse pricing
XM_484214 Rosetta Predictions mouse pricing
XM_896977 Rosetta Predictions mouse pricing
XM_989504 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014974 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016846 predicted 2529
2 SASI_Hs01_00016847 predicted 3991
3 SASI_Hs01_00016848 predicted 1551
4 SASI_Hs01_00016850 predicted 1868
5 SASI_Hs02_00346687 predicted 1565
6 SASI_Hs01_00016851 predicted 1896
7 SASI_Hs01_00016852 predicted 890
8 SASI_Hs01_00016854 predicted 1403
9 SASI_Hs01_00016855 predicted 1221
10 SASI_Hs02_00346688 predicted 1485
11 SASI_Hs01_00016849 predicted 1693
12 SASI_Hs01_00016853 predicted 1390
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107360 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228055 predicted 3639
2 SASI_Rn02_00228056 predicted 2097
3 SASI_Rn02_00228057 predicted 4428
4 SASI_Rn02_00228058 predicted 2812
5 SASI_Rn02_00228059 predicted 1307
6 SASI_Rn02_00228060 predicted 1655
7 SASI_Rn02_00228061 predicted 3724
8 SASI_Rn02_00228062 predicted 979
9 SASI_Rn02_00228063 predicted 4389
10 SASI_Rn02_00228064 predicted 4689
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081426 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298271 predicted 1758
2 SASI_Mm02_00298272 predicted 1521
3 SASI_Mm02_00298273 predicted 3038
4 SASI_Mm02_00298274 predicted 1881
5 SASI_Mm02_00298275 predicted 1151
6 SASI_Mm02_00298276 predicted 1191
7 SASI_Mm02_00298277 predicted 3853
8 SASI_Mm02_00298278 predicted 4515
9 SASI_Mm02_00298279 predicted 2765
10 SASI_Mm02_00298280 predicted 4430
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_484214 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00202047 predicted 1757
2 SASI_Mm01_00202048 predicted 1526
3 SASI_Mm01_00202049 predicted 3031
4 SASI_Mm01_00202050 predicted 1935
5 SASI_Mm01_00202051 predicted 1886
6 SASI_Mm01_00202052 predicted 1206
7 SASI_Mm01_00202053 predicted 3861
8 SASI_Mm01_00202054 predicted 4519
9 SASI_Mm01_00202055 predicted 2767
10 SASI_Mm01_00202056 predicted 4430
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896977 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00260721 predicted 1759
2 SASI_Mm01_00260722 predicted 1533
3 SASI_Mm01_00260723 predicted 3034
4 SASI_Mm01_00260724 predicted 1944
5 SASI_Mm01_00260725 predicted 1882
6 SASI_Mm01_00260726 predicted 1197
7 SASI_Mm01_00260727 predicted 3861
8 SASI_Mm01_00260728 predicted 4515
9 SASI_Mm01_00260729 predicted 2767
10 SASI_Mm01_00260730 predicted 4436
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_989504 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00278453 predicted 1765
2 SASI_Mm01_00278454 predicted 1533
3 SASI_Mm01_00278455 predicted 3036
4 SASI_Mm01_00278456 predicted 1940
5 SASI_Mm01_00278457 predicted 1879
6 SASI_Mm01_00278458 predicted 1204
7 SASI_Mm01_00278459 predicted 3862
8 SASI_Mm01_00278460 predicted 4526
9 SASI_Mm01_00278461 predicted 2767
10 SASI_Mm01_00278462 predicted 4437
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014974
DIP2C MISSION shRNA Bacterial Glycerol Stock
DIP2 disco-interacting protein 2 homolog C (Drosophila)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130866    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014974.1-4508s1c1
Sequence:CCGGGCTGTGTTTACCTGGACAAATCTCGAGATTTGTCCAGGTAAACACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130718    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014974.1-5596s1c1
Sequence:CCGGGCGTGGATAGTATCACAACAACTCGAGTTGTTGTGATACTATCCACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014974.1-4233s1c1
Sequence:CCGGCCAGCGGTTATTTCACTATTTCTCGAGAAATAGTGAAATAACCGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014974.1-1854s1c1
Sequence:CCGGCGTGTGTGAAATCGAGGGATACTCGAGTATCCCTCGATTTCACACACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128102    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014974.1-6379s1c1
Sequence:CCGGCCGAGAAAGATGTGTTCTGTACTCGAGTACAGAACACATCTTTCTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014974.1-1541s1c1
Sequence:CCGGCCACACATTAAAGATGCCAATCTCGAGATTGGCATCTTTAATGTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014974.1-1419s1c1
Sequence:CCGGCCTGCCATAAAGGACTTCCAACTCGAGTTGGAAGTCCTTTATGGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129743    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014974.1-5597s1c1
Sequence:CCGGCGTGGATAGTATCACAACAAACTCGAGTTTGTTGTGATACTATCCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014974.2-3522s21c1
Sequence:CCGGTGGGATGCTAGCTGGCGTAAACTCGAGTTTACGCCAGCTAGCATCCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014974.2-2755s21c1
Sequence:CCGGCCGCTTGGTGGGATCCATTTACTCGAGTAAATGGATCCCACCAAGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014974.2-1579s21c1
Sequence:CCGCATTGAGTACAAGACGTGTAAGCTCGAGCTTACACGTCTTGTACTCAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014974
DIP2C MISSION shRNA shRNA Plasmid DNA
DIP2 disco-interacting protein 2 homolog C (Drosophila)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130866    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014974.1-4508s1c1
Sequence:CCGGGCTGTGTTTACCTGGACAAATCTCGAGATTTGTCCAGGTAAACACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130718    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014974.1-5596s1c1
Sequence:CCGGGCGTGGATAGTATCACAACAACTCGAGTTGTTGTGATACTATCCACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014974.1-4233s1c1
Sequence:CCGGCCAGCGGTTATTTCACTATTTCTCGAGAAATAGTGAAATAACCGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014974.1-1854s1c1
Sequence:CCGGCGTGTGTGAAATCGAGGGATACTCGAGTATCCCTCGATTTCACACACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128102    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014974.1-6379s1c1
Sequence:CCGGCCGAGAAAGATGTGTTCTGTACTCGAGTACAGAACACATCTTTCTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014974.1-1541s1c1
Sequence:CCGGCCACACATTAAAGATGCCAATCTCGAGATTGGCATCTTTAATGTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014974.1-1419s1c1
Sequence:CCGGCCTGCCATAAAGGACTTCCAACTCGAGTTGGAAGTCCTTTATGGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129743    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014974.1-5597s1c1
Sequence:CCGGCGTGGATAGTATCACAACAAACTCGAGTTTGTTGTGATACTATCCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014974.2-3522s21c1
Sequence:CCGGTGGGATGCTAGCTGGCGTAAACTCGAGTTTACGCCAGCTAGCATCCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014974.2-2755s21c1
Sequence:CCGGCCGCTTGGTGGGATCCATTTACTCGAGTAAATGGATCCCACCAAGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014974.2-1579s21c1
Sequence:CCGCATTGAGTACAAGACGTGTAAGCTCGAGCTTACACGTCTTGTACTCAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014974
DIP2C MISSION shRNA Lentiviral Transduction Particles
DIP2 disco-interacting protein 2 homolog C (Drosophila)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130866    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014974.1-4508s1c1
Sequence:CCGGGCTGTGTTTACCTGGACAAATCTCGAGATTTGTCCAGGTAAACACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130718    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014974.1-5596s1c1
Sequence:CCGGGCGTGGATAGTATCACAACAACTCGAGTTGTTGTGATACTATCCACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014974.1-4233s1c1
Sequence:CCGGCCAGCGGTTATTTCACTATTTCTCGAGAAATAGTGAAATAACCGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014974.1-1854s1c1
Sequence:CCGGCGTGTGTGAAATCGAGGGATACTCGAGTATCCCTCGATTTCACACACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128102    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014974.1-6379s1c1
Sequence:CCGGCCGAGAAAGATGTGTTCTGTACTCGAGTACAGAACACATCTTTCTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014974.1-1541s1c1
Sequence:CCGGCCACACATTAAAGATGCCAATCTCGAGATTGGCATCTTTAATGTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014974.1-1419s1c1
Sequence:CCGGCCTGCCATAAAGGACTTCCAACTCGAGTTGGAAGTCCTTTATGGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129743    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014974.1-5597s1c1
Sequence:CCGGCGTGGATAGTATCACAACAAACTCGAGTTTGTTGTGATACTATCCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014974.2-3522s21c1
Sequence:CCGGTGGGATGCTAGCTGGCGTAAACTCGAGTTTACGCCAGCTAGCATCCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014974.2-2755s21c1
Sequence:CCGGCCGCTTGGTGGGATCCATTTACTCGAGTAAATGGATCCCACCAAGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014974.2-1579s21c1
Sequence:CCGCATTGAGTACAAGACGTGTAAGCTCGAGCTTACACGTCTTGTACTCAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081426
VALIDATED
DIP2C MISSION shRNA Bacterial Glycerol Stock
DIP2 disco-interacting protein 2 homolog C (Drosophila)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000249876    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081426.1-7819s21c1
Sequence:CCGGTGAATGTTAGCAGCGTTATTTCTCGAGAAATAACGCTGCTAACATTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081426.1-1945s21c1
Sequence:CCGGATTGAGTATAAGACGTGTAAACTCGAGTTTACACGTCTTATACTCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081426.1-2322s21c1
Sequence:CCGGAGCAAATCCCTGGTCTATTTCCTCGAGGAAATAGACCAGGGATTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081426.1-1234s21c1
Sequence:CCGGCAGCTTGTCAATACCCTTAAACTCGAGTTTAAGGGTATTGACAAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081426.1-2191s21c1
Sequence:CCGGCAGAAGGTCTGCCAGTATAAACTCGAGTTTATACTGGCAGACCTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081426
VALIDATED
DIP2C MISSION shRNA shRNA Plasmid DNA
DIP2 disco-interacting protein 2 homolog C (Drosophila)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000249876    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081426.1-7819s21c1
Sequence:CCGGTGAATGTTAGCAGCGTTATTTCTCGAGAAATAACGCTGCTAACATTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081426.1-1945s21c1
Sequence:CCGGATTGAGTATAAGACGTGTAAACTCGAGTTTACACGTCTTATACTCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081426.1-2322s21c1
Sequence:CCGGAGCAAATCCCTGGTCTATTTCCTCGAGGAAATAGACCAGGGATTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081426.1-1234s21c1
Sequence:CCGGCAGCTTGTCAATACCCTTAAACTCGAGTTTAAGGGTATTGACAAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081426.1-2191s21c1
Sequence:CCGGCAGAAGGTCTGCCAGTATAAACTCGAGTTTATACTGGCAGACCTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081426
VALIDATED
DIP2C MISSION shRNA Lentiviral Transduction Particles
DIP2 disco-interacting protein 2 homolog C (Drosophila)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000249876    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081426.1-7819s21c1
Sequence:CCGGTGAATGTTAGCAGCGTTATTTCTCGAGAAATAACGCTGCTAACATTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081426.1-1945s21c1
Sequence:CCGGATTGAGTATAAGACGTGTAAACTCGAGTTTACACGTCTTATACTCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081426.1-2322s21c1
Sequence:CCGGAGCAAATCCCTGGTCTATTTCCTCGAGGAAATAGACCAGGGATTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081426.1-1234s21c1
Sequence:CCGGCAGCTTGTCAATACCCTTAAACTCGAGTTTAAGGGTATTGACAAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081426.1-2191s21c1
Sequence:CCGGCAGAAGGTCTGCCAGTATAAACTCGAGTTTATACTGGCAGACCTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)