EMAIL THIS PAGE TO A FRIEND

DIRC1

disrupted in renal carcinoma 1

28 Gene Product Result for
UniProtKB ID: Q969H9, Q08AK1
Gene ID:
Human(116093) Summary: This gene consists of two exons and encodes a 104aa protein. Disruption of this gene by translocation t(2;3)(q33;q21) is associated with familial clear cell renal cancer. [provided by RefSeq, Sep 2010]
cow(101906616) disrupted in renal carcinoma 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_052952 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052952 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052952 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052952 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052952 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156199 predicted 496
2 SASI_Hs01_00156200 predicted 342
3 SASI_Hs01_00156201 predicted 516
4 SASI_Hs01_00156202 predicted 518
5 SASI_Hs01_00156203 predicted 500
6 SASI_Hs01_00156205 predicted 336
7 SASI_Hs01_00156206 predicted 518
8 SASI_Hs01_00156207 predicted 491
9 SASI_Hs01_00156208 predicted 351
10 SASI_Hs02_00361751 predicted 416
11 SASI_Hs01_00156204 predicted 325
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052952
DIRC1 MISSION shRNA Bacterial Glycerol Stock
disrupted in renal carcinoma 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052952.1-418s1c1
Sequence:CCGGGTTCTTCTGCTGCTGCAACATCTCGAGATGTTGCAGCAGCAGAAGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129735    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052952.1-492s1c1
Sequence:CCGGCAACTTTCTTCTAGGTCTGAACTCGAGTTCAGACCTAGAAGAAAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052952.1-341s1c1
Sequence:CCGGGAAGCCTGTTTCCTGTTACTTCTCGAGAAGTAACAGGAAACAGGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052952.1-515s1c1
Sequence:CCGGGAATACTGTGAGGCTAAAGTGCTCGAGCACTTTAGCCTCACAGTATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052952.1-489s1c1
Sequence:CCGGGATCAACTTTCTTCTAGGTCTCTCGAGAGACCTAGAAGAAAGTTGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052952.1-444s1c1
Sequence:CCGGCCTTCCATCATCTCAGACACACTCGAGTGTGTCTGAGATGATGGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434237    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052952.2-1038s21c1
Sequence:CCGGATATGCTGTAGAGCAAATTAACTCGAGTTAATTTGCTCTACAGCATATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052952.2-569s21c1
Sequence:CCGGCAACTAAGCCTTACCTAATTACTCGAGTAATTAGGTAAGGCTTAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432831    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052952.2-995s21c1
Sequence:CCGGGTTACGTTAGCCTGCATTAAACTCGAGTTTAATGCAGGCTAACGTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052952.2-393s21c1
Sequence:CCGGTAGAGGTCCAGAATGCTCAAACTCGAGTTTGAGCATTCTGGACCTCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052952
DIRC1 MISSION shRNA shRNA Plasmid DNA
disrupted in renal carcinoma 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052952.1-418s1c1
Sequence:CCGGGTTCTTCTGCTGCTGCAACATCTCGAGATGTTGCAGCAGCAGAAGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129735    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052952.1-492s1c1
Sequence:CCGGCAACTTTCTTCTAGGTCTGAACTCGAGTTCAGACCTAGAAGAAAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052952.1-341s1c1
Sequence:CCGGGAAGCCTGTTTCCTGTTACTTCTCGAGAAGTAACAGGAAACAGGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052952.1-515s1c1
Sequence:CCGGGAATACTGTGAGGCTAAAGTGCTCGAGCACTTTAGCCTCACAGTATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052952.1-489s1c1
Sequence:CCGGGATCAACTTTCTTCTAGGTCTCTCGAGAGACCTAGAAGAAAGTTGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000131008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052952.1-444s1c1
Sequence:CCGGCCTTCCATCATCTCAGACACACTCGAGTGTGTCTGAGATGATGGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434237    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052952.2-1038s21c1
Sequence:CCGGATATGCTGTAGAGCAAATTAACTCGAGTTAATTTGCTCTACAGCATATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052952.2-569s21c1
Sequence:CCGGCAACTAAGCCTTACCTAATTACTCGAGTAATTAGGTAAGGCTTAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432831    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052952.2-995s21c1
Sequence:CCGGGTTACGTTAGCCTGCATTAAACTCGAGTTTAATGCAGGCTAACGTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052952.2-393s21c1
Sequence:CCGGTAGAGGTCCAGAATGCTCAAACTCGAGTTTGAGCATTCTGGACCTCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052952
DIRC1 MISSION shRNA Lentiviral Transduction Particles
disrupted in renal carcinoma 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052952.1-418s1c1
Sequence:CCGGGTTCTTCTGCTGCTGCAACATCTCGAGATGTTGCAGCAGCAGAAGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129735    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052952.1-492s1c1
Sequence:CCGGCAACTTTCTTCTAGGTCTGAACTCGAGTTCAGACCTAGAAGAAAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052952.1-341s1c1
Sequence:CCGGGAAGCCTGTTTCCTGTTACTTCTCGAGAAGTAACAGGAAACAGGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052952.1-515s1c1
Sequence:CCGGGAATACTGTGAGGCTAAAGTGCTCGAGCACTTTAGCCTCACAGTATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052952.1-489s1c1
Sequence:CCGGGATCAACTTTCTTCTAGGTCTCTCGAGAGACCTAGAAGAAAGTTGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052952.1-444s1c1
Sequence:CCGGCCTTCCATCATCTCAGACACACTCGAGTGTGTCTGAGATGATGGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434237    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052952.2-1038s21c1
Sequence:CCGGATATGCTGTAGAGCAAATTAACTCGAGTTAATTTGCTCTACAGCATATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052952.2-569s21c1
Sequence:CCGGCAACTAAGCCTTACCTAATTACTCGAGTAATTAGGTAAGGCTTAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432831    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052952.2-995s21c1
Sequence:CCGGGTTACGTTAGCCTGCATTAAACTCGAGTTTAATGCAGGCTAACGTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052952.2-393s21c1
Sequence:CCGGTAGAGGTCCAGAATGCTCAAACTCGAGTTTGAGCATTCTGGACCTCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)