EMAIL THIS PAGE TO A FRIEND

DISP2

dispatched homolog 2 (Drosophila)

82 Gene Product Result for
Synonyms: DISPB HsT16908
UniProtKB ID: A7MBM2, Q6AHW3, Q9C0C1
Gene ID:
Human(85455) Summary: The pattern of cellular proliferation and differentiation that leads to normal development of embryonic structures often depends upon the localized production of secreted protein signals. Cells surrounding the source of a particular signal respond in a graded manner according to the effective concentration of the signal, and this response produces the pattern of cell types constituting the mature structure. A segment-polarity gene known as dispatched has been identified in Drosophila and its protein product is required for normal Hedgehog (Hh) signaling. This gene is one of two human homologs of Drosophila dispatched. [provided by RefSeq, Jul 2008]
Mouse(214240) dispatched homolog 2 (Drosophila)
Rat(311324) dispatched homolog 2 (Drosophila)
naked mole-rat(101709229) dispatched homolog 2 (Drosophila)
domestic guinea pig(100729286) dispatched homolog 2 (Drosophila)
sheep(101113596) dispatched homolog 2 (Drosophila)
Zebrafish(405793) dispatched homolog 2 (Drosophila)
chicken(428836) dispatched homolog 2 (Drosophila)
cow(512474) dispatched homolog 2 (Drosophila)
Horse(100071435) dispatched homolog 2 (Drosophila)
domestic cat(101090441) dispatched homolog 2 (Drosophila)
dog(487494) dispatched homolog 2 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033510 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033510 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033510 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_170593 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_170593 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_170593 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033510 Rosetta Predictions human pricing
NM_001107759 Rosetta Predictions rat pricing
NM_170593 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033510 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032339 predicted 3345
2 SASI_Hs01_00032340 predicted 3979
3 SASI_Hs01_00032341 predicted 1107
4 SASI_Hs01_00032342 predicted 4354
5 SASI_Hs02_00361392 predicted 3413
6 SASI_Hs01_00032343 predicted 3170
7 SASI_Hs02_00361393 predicted 955
8 SASI_Hs01_00032345 predicted 3091
9 SASI_Hs01_00032346 predicted 2541
10 SASI_Hs01_00032347 predicted 1303
11 SASI_Hs01_00032344 predicted 931
12 SASI_Hs01_00032348 predicted 3190
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107759 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231985 predicted 1017
2 SASI_Rn02_00231986 predicted 1427
3 SASI_Rn02_00231987 predicted 1563
4 SASI_Rn02_00231988 predicted 1235
5 SASI_Rn02_00231989 predicted 1244
6 SASI_Rn02_00231990 predicted 1438
7 SASI_Rn02_00231991 predicted 1270
8 SASI_Rn02_00231992 predicted 1116
9 SASI_Rn02_00231993 predicted 1251
10 SASI_Rn02_00231994 predicted 1600
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170593 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00052419 predicted 1349
2 SASI_Mm01_00052420 predicted 2138
3 SASI_Mm02_00343554 predicted 201
4 SASI_Mm01_00052421 predicted 920
5 SASI_Mm02_00343555 predicted 1480
6 SASI_Mm02_00343556 predicted 1536
7 SASI_Mm01_00052422 predicted 3979
8 SASI_Mm01_00052423 predicted 2682
9 SASI_Mm01_00052424 predicted 2469
10 SASI_Mm01_00052425 predicted 2002
11 SASI_Mm01_00052426 predicted 219
12 SASI_Mm01_00052427 predicted 974
13 SASI_Mm01_00052428 predicted 3928
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033510
DISP2 MISSION shRNA Bacterial Glycerol Stock
dispatched homolog 2 (Drosophila)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219953    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033510.1-4410s1c1
Sequence:CCGGCCCTCCAGCTGTGGATGTTAACTCGAGTTAACATCCACAGCTGGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033510.1-3189s1c1
Sequence:CCGGGTCAACTACTGCATCTCCTATCTCGAGATAGGAGATGCAGTAGTTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033510.1-1473s1c1
Sequence:CCGGCTTGCTGACAACTACACCTCTCTCGAGAGAGGTGTAGTTGTCAGCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033510.1-557s1c1
Sequence:CCGGGATGCCAAAGAGCTATTCCCACTCGAGTGGGAATAGCTCTTTGGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219954    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033510.1-4857s1c1
Sequence:CCGGCACCGGTTTGACCAGAAATTCCTCGAGGAATTTCTGGTCAAACCGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033510.1-3396s1c1
Sequence:CCGGGCCAGCTTCTTCTTCCAATCTCTCGAGAGATTGGAAGAAGAAGCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033510.1-1005s1c1
Sequence:CCGGCATTCCATGTGTCGCATGGAACTCGAGTTCCATGCGACACATGGAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033510.1-1328s1c1
Sequence:CCGGCTTTCTGCTTGACAGGGACTTCTCGAGAAGTCCCTGTCAAGCAGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033510.1-1001s1c1
Sequence:CCGGCATCCATTCCATGTGTCGCATCTCGAGATGCGACACATGGAATGGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033510.1-710s1c1
Sequence:CCGGCACAGACATTGGGAGCAAGTTCTCGAGAACTTGCTCCCAATGTCTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033510
DISP2 MISSION shRNA shRNA Plasmid DNA
dispatched homolog 2 (Drosophila)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219953    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033510.1-4410s1c1
Sequence:CCGGCCCTCCAGCTGTGGATGTTAACTCGAGTTAACATCCACAGCTGGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033510.1-3189s1c1
Sequence:CCGGGTCAACTACTGCATCTCCTATCTCGAGATAGGAGATGCAGTAGTTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033510.1-1473s1c1
Sequence:CCGGCTTGCTGACAACTACACCTCTCTCGAGAGAGGTGTAGTTGTCAGCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033510.1-557s1c1
Sequence:CCGGGATGCCAAAGAGCTATTCCCACTCGAGTGGGAATAGCTCTTTGGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219954    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033510.1-4857s1c1
Sequence:CCGGCACCGGTTTGACCAGAAATTCCTCGAGGAATTTCTGGTCAAACCGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033510.1-3396s1c1
Sequence:CCGGGCCAGCTTCTTCTTCCAATCTCTCGAGAGATTGGAAGAAGAAGCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033510.1-1005s1c1
Sequence:CCGGCATTCCATGTGTCGCATGGAACTCGAGTTCCATGCGACACATGGAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033510.1-1328s1c1
Sequence:CCGGCTTTCTGCTTGACAGGGACTTCTCGAGAAGTCCCTGTCAAGCAGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033510.1-1001s1c1
Sequence:CCGGCATCCATTCCATGTGTCGCATCTCGAGATGCGACACATGGAATGGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033510.1-710s1c1
Sequence:CCGGCACAGACATTGGGAGCAAGTTCTCGAGAACTTGCTCCCAATGTCTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033510
DISP2 MISSION shRNA Lentiviral Transduction Particles
dispatched homolog 2 (Drosophila)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000219953    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033510.1-4410s1c1
Sequence:CCGGCCCTCCAGCTGTGGATGTTAACTCGAGTTAACATCCACAGCTGGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033510.1-3189s1c1
Sequence:CCGGGTCAACTACTGCATCTCCTATCTCGAGATAGGAGATGCAGTAGTTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033510.1-1473s1c1
Sequence:CCGGCTTGCTGACAACTACACCTCTCTCGAGAGAGGTGTAGTTGTCAGCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033510.1-557s1c1
Sequence:CCGGGATGCCAAAGAGCTATTCCCACTCGAGTGGGAATAGCTCTTTGGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219954    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033510.1-4857s1c1
Sequence:CCGGCACCGGTTTGACCAGAAATTCCTCGAGGAATTTCTGGTCAAACCGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033510.1-3396s1c1
Sequence:CCGGGCCAGCTTCTTCTTCCAATCTCTCGAGAGATTGGAAGAAGAAGCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033510.1-1005s1c1
Sequence:CCGGCATTCCATGTGTCGCATGGAACTCGAGTTCCATGCGACACATGGAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033510.1-1328s1c1
Sequence:CCGGCTTTCTGCTTGACAGGGACTTCTCGAGAAGTCCCTGTCAAGCAGAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033510.1-1001s1c1
Sequence:CCGGCATCCATTCCATGTGTCGCATCTCGAGATGCGACACATGGAATGGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033510.1-710s1c1
Sequence:CCGGCACAGACATTGGGAGCAAGTTCTCGAGAACTTGCTCCCAATGTCTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_170593
DISP2 MISSION shRNA Bacterial Glycerol Stock
dispatched homolog 2 (Drosophila)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000181299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170593.1-3143s1c1
Sequence:CCGGCCTTCCACTATACTGCTCTATCTCGAGATAGAGCAGTATAGTGGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170593.1-3142s1c1
Sequence:CCGGGCCTTCCACTATACTGCTCTACTCGAGTAGAGCAGTATAGTGGAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170593.1-2989s1c1
Sequence:CCGGCCTCTCTGTAGACTTAACCATCTCGAGATGGTTAAGTCTACAGAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170593.1-1282s1c1
Sequence:CCGGCCCAATTAAAGTCTCTGACAACTCGAGTTGTCAGAGACTTTAATTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_170593
DISP2 MISSION shRNA shRNA Plasmid DNA
dispatched homolog 2 (Drosophila)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000181299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170593.1-3143s1c1
Sequence:CCGGCCTTCCACTATACTGCTCTATCTCGAGATAGAGCAGTATAGTGGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170593.1-3142s1c1
Sequence:CCGGGCCTTCCACTATACTGCTCTACTCGAGTAGAGCAGTATAGTGGAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170593.1-2989s1c1
Sequence:CCGGCCTCTCTGTAGACTTAACCATCTCGAGATGGTTAAGTCTACAGAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170593.1-1282s1c1
Sequence:CCGGCCCAATTAAAGTCTCTGACAACTCGAGTTGTCAGAGACTTTAATTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_170593
DISP2 MISSION shRNA Lentiviral Transduction Particles
dispatched homolog 2 (Drosophila)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000181299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170593.1-3143s1c1
Sequence:CCGGCCTTCCACTATACTGCTCTATCTCGAGATAGAGCAGTATAGTGGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170593.1-3142s1c1
Sequence:CCGGGCCTTCCACTATACTGCTCTACTCGAGTAGAGCAGTATAGTGGAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170593.1-2989s1c1
Sequence:CCGGCCTCTCTGTAGACTTAACCATCTCGAGATGGTTAAGTCTACAGAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170593.1-1282s1c1
Sequence:CCGGCCCAATTAAAGTCTCTGACAACTCGAGTTGTCAGAGACTTTAATTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)