EMAIL THIS PAGE TO A FRIEND

DMRT3

doublesex and mab-3 related transcription factor 3

127 Gene Product Result for
Synonyms: DMRTA3
UniProtKB ID: Q9NQL9, Q7LA03, Q7LCH8, Q96SC7, Q9NRQ9
Gene ID:
Mouse(240590) doublesex and mab-3 related transcription factor 3
Rat(293976) doublesex and mab-3 related transcription factor 3
chicken(431641) doublesex and mab-3 related transcription factor 3
domestic cat(101083627) doublesex and mab-3 related transcription factor 3
dog(609208) doublesex and mab-3 related transcription factor 3
sheep(101116889) doublesex and mab-3 related transcription factor 3
domestic guinea pig(100723375) doublesex and mab-3 related transcription factor 3
naked mole-rat(101704743) doublesex and mab-3 related transcription factor 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021240 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021240 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021240 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177360 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177360 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177360 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021240 Rosetta Predictions human pricing
NM_001106358 Rosetta Predictions rat pricing
NM_177360 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021240 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092337 predicted 1684
2 SASI_Hs02_00354879 predicted 1522
3 SASI_Hs01_00092338 predicted 1772
4 SASI_Hs02_00354880 predicted 1653
5 SASI_Hs01_00092341 predicted 1350
6 SASI_Hs01_00092342 predicted 1885
7 SASI_Hs01_00092343 predicted 954
8 SASI_Hs01_00092344 predicted 1435
9 SASI_Hs02_00354881 predicted 1869
10 SASI_Hs02_00354882 predicted 1555
11 SASI_Hs01_00092339 predicted 1440
12 SASI_Hs01_00092340 predicted 1667
13 SASI_Hs01_00092345 predicted 1370
14 SASI_Hs01_00092346 predicted 1745
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106358 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218188 predicted 1422
2 SASI_Rn02_00218189 predicted 406
3 SASI_Rn02_00218190 predicted 2098
4 SASI_Rn02_00218191 predicted 2053
5 SASI_Rn02_00218192 predicted 2009
6 SASI_Rn02_00218193 predicted 2005
7 SASI_Rn02_00218194 predicted 2120
8 SASI_Rn02_00218195 predicted 699
9 SASI_Rn02_00218196 predicted 1190
10 SASI_Rn02_00218197 predicted 1057
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177360 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00040300 predicted 2125
2 SASI_Mm01_00040301 predicted 2093
3 SASI_Mm01_00040302 predicted 1997
4 SASI_Mm01_00040303 predicted 1668
5 SASI_Mm01_00040304 predicted 1904
6 SASI_Mm01_00040305 predicted 714
7 SASI_Mm01_00040306 predicted 1612
8 SASI_Mm01_00040307 predicted 2112
9 SASI_Mm01_00040308 predicted 782
10 SASI_Mm01_00040309 predicted 1803
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021240
DMRT3 MISSION shRNA Bacterial Glycerol Stock
doublesex and mab-3 related transcription factor 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433741    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021240.2-1761s21c1
Sequence:CCGGAGGTCAGCCTTGCACCTAAACCTCGAGGTTTAGGTGCAAGGCTGACCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414566    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021240.2-1885s21c1
Sequence:CCGGGACTATAAACAGGGACATTATCTCGAGATAATGTCCCTGTTTATAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021240.2-1387s21c1
Sequence:CCGGTTTACACCGAGGACGACTATGCTCGAGCATAGTCGTCCTCGGTGTAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021240.2-1350s1c1
Sequence:CCGGCCTGATGATGGGTGTCCATTTCTCGAGAAATGGACACCCATCATCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021240.2-971s1c1
Sequence:CCGGGCACATCTTTGAACACACCTTCTCGAGAAGGTGTGTTCAAAGATGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021240.2-537s1c1
Sequence:CCGGACAGAGGTCTTCAGTGACAAACTCGAGTTTGTCACTGAAGACCTCTGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021240.2-1424s1c1
Sequence:CCGGCTCAGACTCTAGAACACTCAACTCGAGTTGAGTGTTCTAGAGTCTGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021240.2-170s1c1
Sequence:CCGGCAAGCGTTACTGCCGCTTCAACTCGAGTTGAAGCGGCAGTAACGCTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021240
DMRT3 MISSION shRNA shRNA Plasmid DNA
doublesex and mab-3 related transcription factor 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433741    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021240.2-1761s21c1
Sequence:CCGGAGGTCAGCCTTGCACCTAAACCTCGAGGTTTAGGTGCAAGGCTGACCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414566    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021240.2-1885s21c1
Sequence:CCGGGACTATAAACAGGGACATTATCTCGAGATAATGTCCCTGTTTATAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021240.2-1387s21c1
Sequence:CCGGTTTACACCGAGGACGACTATGCTCGAGCATAGTCGTCCTCGGTGTAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021240.2-1350s1c1
Sequence:CCGGCCTGATGATGGGTGTCCATTTCTCGAGAAATGGACACCCATCATCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021240.2-971s1c1
Sequence:CCGGGCACATCTTTGAACACACCTTCTCGAGAAGGTGTGTTCAAAGATGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021240.2-537s1c1
Sequence:CCGGACAGAGGTCTTCAGTGACAAACTCGAGTTTGTCACTGAAGACCTCTGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021240.2-1424s1c1
Sequence:CCGGCTCAGACTCTAGAACACTCAACTCGAGTTGAGTGTTCTAGAGTCTGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021240.2-170s1c1
Sequence:CCGGCAAGCGTTACTGCCGCTTCAACTCGAGTTGAAGCGGCAGTAACGCTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021240
DMRT3 MISSION shRNA Lentiviral Transduction Particles
doublesex and mab-3 related transcription factor 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433741    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021240.2-1761s21c1
Sequence:CCGGAGGTCAGCCTTGCACCTAAACCTCGAGGTTTAGGTGCAAGGCTGACCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414566    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021240.2-1885s21c1
Sequence:CCGGGACTATAAACAGGGACATTATCTCGAGATAATGTCCCTGTTTATAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021240.2-1387s21c1
Sequence:CCGGTTTACACCGAGGACGACTATGCTCGAGCATAGTCGTCCTCGGTGTAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021240.2-1350s1c1
Sequence:CCGGCCTGATGATGGGTGTCCATTTCTCGAGAAATGGACACCCATCATCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021240.2-971s1c1
Sequence:CCGGGCACATCTTTGAACACACCTTCTCGAGAAGGTGTGTTCAAAGATGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021240.2-537s1c1
Sequence:CCGGACAGAGGTCTTCAGTGACAAACTCGAGTTTGTCACTGAAGACCTCTGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021240.2-1424s1c1
Sequence:CCGGCTCAGACTCTAGAACACTCAACTCGAGTTGAGTGTTCTAGAGTCTGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021240.2-170s1c1
Sequence:CCGGCAAGCGTTACTGCCGCTTCAACTCGAGTTGAAGCGGCAGTAACGCTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177360
DMRT3 MISSION shRNA Bacterial Glycerol Stock
doublesex and mab-3 related transcription factor 3
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000422263    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177360.3-1996s21c1
Sequence:CCGGGTCAGCTTTACTCCCTAAATTCTCGAGAATTTAGGGAGTAAAGCTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426847    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177360.3-1813s21c1
Sequence:CCGGGACTGTGCTTGATAGTCTATACTCGAGTATAGACTATCAAGCACAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086168    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177360.2-1773s1c1
Sequence:CCGGCCACTAATACTGTATACTCTTCTCGAGAAGAGTATACAGTATTAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177360.2-1616s1c1
Sequence:CCGGCAGTCCATCTACACAGAGGATCTCGAGATCCTCTGTGTAGATGGACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177360.2-427s1c1
Sequence:CCGGCGAGAAGTGCATCCTGATAATCTCGAGATTATCAGGATGCACTTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177360.2-1659s1c1
Sequence:CCGGCCTCGGATTCTAGAATACTCACTCGAGTGAGTATTCTAGAATCCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177360.2-1203s1c1
Sequence:CCGGGCGGCCATATCTTTGAACACACTCGAGTGTGTTCAAAGATATGGCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177360
DMRT3 MISSION shRNA shRNA Plasmid DNA
doublesex and mab-3 related transcription factor 3
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000422263    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177360.3-1996s21c1
Sequence:CCGGGTCAGCTTTACTCCCTAAATTCTCGAGAATTTAGGGAGTAAAGCTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426847    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177360.3-1813s21c1
Sequence:CCGGGACTGTGCTTGATAGTCTATACTCGAGTATAGACTATCAAGCACAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086168    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177360.2-1773s1c1
Sequence:CCGGCCACTAATACTGTATACTCTTCTCGAGAAGAGTATACAGTATTAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177360.2-1616s1c1
Sequence:CCGGCAGTCCATCTACACAGAGGATCTCGAGATCCTCTGTGTAGATGGACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177360.2-427s1c1
Sequence:CCGGCGAGAAGTGCATCCTGATAATCTCGAGATTATCAGGATGCACTTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177360.2-1659s1c1
Sequence:CCGGCCTCGGATTCTAGAATACTCACTCGAGTGAGTATTCTAGAATCCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177360.2-1203s1c1
Sequence:CCGGGCGGCCATATCTTTGAACACACTCGAGTGTGTTCAAAGATATGGCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177360
DMRT3 MISSION shRNA Lentiviral Transduction Particles
doublesex and mab-3 related transcription factor 3
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000422263    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177360.3-1996s21c1
Sequence:CCGGGTCAGCTTTACTCCCTAAATTCTCGAGAATTTAGGGAGTAAAGCTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426847    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177360.3-1813s21c1
Sequence:CCGGGACTGTGCTTGATAGTCTATACTCGAGTATAGACTATCAAGCACAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086168    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177360.2-1773s1c1
Sequence:CCGGCCACTAATACTGTATACTCTTCTCGAGAAGAGTATACAGTATTAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177360.2-1616s1c1
Sequence:CCGGCAGTCCATCTACACAGAGGATCTCGAGATCCTCTGTGTAGATGGACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177360.2-427s1c1
Sequence:CCGGCGAGAAGTGCATCCTGATAATCTCGAGATTATCAGGATGCACTTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177360.2-1659s1c1
Sequence:CCGGCCTCGGATTCTAGAATACTCACTCGAGTGAGTATTCTAGAATCCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177360.2-1203s1c1
Sequence:CCGGGCGGCCATATCTTTGAACACACTCGAGTGTGTTCAAAGATATGGCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)