EMAIL THIS PAGE TO A FRIEND

DNAJB3

DnaJ (Hsp40) homolog, subfamily B, member 3

72 Gene Product Result for
Synonyms: HCG3
UniProtKB ID: Q8WWF6
Gene ID:
Mouse(15504) DnaJ (Hsp40) homolog, subfamily B, member 3
Rat(680216) DnaJ (Hsp40) homolog, subfamily B, member 3
cow(528549) DnaJ (Hsp40) homolog, subfamily B, member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008299 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008299 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008299 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001001394 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001394 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001394 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU163411 MISSION® esiRNA esiRNA targeting mouse Dnajb3 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001394 Rosetta Predictions human pricing
NM_001109396 Rosetta Predictions rat pricing
NM_008299 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001394 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00136791 predicted 945
2 SASI_Hs02_00303731 predicted 976
3 SASI_Hs01_00136784 predicted 819
4 SASI_Hs01_00136785 predicted 277
5 SASI_Hs01_00136786 predicted 829
6 SASI_Hs01_00136787 predicted 719
7 SASI_Hs01_00136788 predicted 828
8 SASI_Hs01_00136789 predicted 882
9 SASI_Hs01_00136790 predicted 886
10 SASI_Hs01_00136792 predicted 271
11 SASI_Hs01_00136793 predicted 827
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109396 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00248006 predicted 633
2 SASI_Rn02_00248007 predicted 548
3 SASI_Rn02_00248008 predicted 218
4 SASI_Rn02_00248009 predicted 679
5 SASI_Rn02_00248010 predicted 788
6 SASI_Rn02_00248011 predicted 493
7 SASI_Rn02_00248012 predicted 773
8 SASI_Rn02_00248013 predicted 718
9 SASI_Rn02_00248014 predicted 742
10 SASI_Rn02_00248015 predicted 621
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008299 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00095961 predicted 388
2 SASI_Mm01_00095963 predicted 215
3 SASI_Mm01_00095965 predicted 550
4 SASI_Mm02_00313582 predicted 481
5 SASI_Mm01_00095969 predicted 493
6 SASI_Mm02_00313583 predicted 526
7 SASI_Mm02_00313584 predicted 391
8 SASI_Mm02_00313585 predicted 553
9 SASI_Mm02_00313586 predicted 501
10 SASI_Mm02_00313587 predicted 225
11 SASI_Mm01_00095960 predicted 779
12 SASI_Mm01_00095962 predicted 688
13 SASI_Mm01_00095964 predicted 745
14 SASI_Mm01_00095966 predicted 766
15 SASI_Mm01_00095967 predicted 648
16 SASI_Mm01_00095968 predicted 647
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008299
DNAJB3 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily B, member 3
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008299.3-697s21c1
Sequence:CCGGCGTTGAGAATGGTCAAGAAAGCTCGAGCTTTCTTGACCATTCTCAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008299.3-325s21c1
Sequence:CCGGCGATGCCTTCCAGTACGTCTTCTCGAGAAGACGTACTGGAAGGCATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008299.1-632s1c1
Sequence:CCGGGCAACTACAAGTCGGTGTCAACTCGAGTTGACACCGACTTGTAGTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008544    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008299.1-864s1c1
Sequence:CCGGTCTACTTTCAGAACAACTGTACTCGAGTACAGTTGTTCTGAAAGTAGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008299.1-545s1c1
Sequence:CCGGCGTTAGATACTGGATTCACATCTCGAGATGTGAATCCAGTATCTAACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008299.1-780s1c1
Sequence:CCGGGCTTCGCATCAATACTCAGTACTCGAGTACTGAGTATTGATGCGAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008299
DNAJB3 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily B, member 3
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008299.3-697s21c1
Sequence:CCGGCGTTGAGAATGGTCAAGAAAGCTCGAGCTTTCTTGACCATTCTCAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008299.3-325s21c1
Sequence:CCGGCGATGCCTTCCAGTACGTCTTCTCGAGAAGACGTACTGGAAGGCATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008299.1-632s1c1
Sequence:CCGGGCAACTACAAGTCGGTGTCAACTCGAGTTGACACCGACTTGTAGTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008544    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008299.1-864s1c1
Sequence:CCGGTCTACTTTCAGAACAACTGTACTCGAGTACAGTTGTTCTGAAAGTAGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008299.1-545s1c1
Sequence:CCGGCGTTAGATACTGGATTCACATCTCGAGATGTGAATCCAGTATCTAACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008299.1-780s1c1
Sequence:CCGGGCTTCGCATCAATACTCAGTACTCGAGTACTGAGTATTGATGCGAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008299
DNAJB3 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily B, member 3
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008299.3-697s21c1
Sequence:CCGGCGTTGAGAATGGTCAAGAAAGCTCGAGCTTTCTTGACCATTCTCAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008299.3-325s21c1
Sequence:CCGGCGATGCCTTCCAGTACGTCTTCTCGAGAAGACGTACTGGAAGGCATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008299.1-632s1c1
Sequence:CCGGGCAACTACAAGTCGGTGTCAACTCGAGTTGACACCGACTTGTAGTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008544    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008299.1-864s1c1
Sequence:CCGGTCTACTTTCAGAACAACTGTACTCGAGTACAGTTGTTCTGAAAGTAGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008299.1-545s1c1
Sequence:CCGGCGTTAGATACTGGATTCACATCTCGAGATGTGAATCCAGTATCTAACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008299.1-780s1c1
Sequence:CCGGGCTTCGCATCAATACTCAGTACTCGAGTACTGAGTATTGATGCGAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001394
DNAJB3 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily B, member 3
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254082    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001394.3-990s21c1
Sequence:CCGGTTGTCTTTCAATCGTTGTAAACTCGAGTTTACAACGATTGAAAGACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001394.3-446s21c1
Sequence:CCGGGAAACCCGCTGGAGAATATTTCTCGAGAAATATTCTCCAGCGGGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001394.3-220s21c1
Sequence:CCGGGAAGCGGAGAGGAGATTCAAGCTCGAGCTTGAATCTCCTCTCCGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001394.3-270s21c1
Sequence:CCGGGGACGCCAAGAAACGCGATATCTCGAGATATCGCGTTTCTTGGCGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001394.3-391s21c1
Sequence:CCGGGACGTCTTCAGGGAGTTCTTCCTCGAGGAAGAACTCCCTGAAGACGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180971    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001394.2-273s1c1
Sequence:CCGGCGCCAAGAAACGCGATATCTACTCGAGTAGATATCGCGTTTCTTGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001394
DNAJB3 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily B, member 3
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254082    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001394.3-990s21c1
Sequence:CCGGTTGTCTTTCAATCGTTGTAAACTCGAGTTTACAACGATTGAAAGACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001394.3-446s21c1
Sequence:CCGGGAAACCCGCTGGAGAATATTTCTCGAGAAATATTCTCCAGCGGGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001394.3-220s21c1
Sequence:CCGGGAAGCGGAGAGGAGATTCAAGCTCGAGCTTGAATCTCCTCTCCGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001394.3-270s21c1
Sequence:CCGGGGACGCCAAGAAACGCGATATCTCGAGATATCGCGTTTCTTGGCGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001394.3-391s21c1
Sequence:CCGGGACGTCTTCAGGGAGTTCTTCCTCGAGGAAGAACTCCCTGAAGACGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180971    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001394.2-273s1c1
Sequence:CCGGCGCCAAGAAACGCGATATCTACTCGAGTAGATATCGCGTTTCTTGGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001394
DNAJB3 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily B, member 3
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254082    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001394.3-990s21c1
Sequence:CCGGTTGTCTTTCAATCGTTGTAAACTCGAGTTTACAACGATTGAAAGACAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001394.3-446s21c1
Sequence:CCGGGAAACCCGCTGGAGAATATTTCTCGAGAAATATTCTCCAGCGGGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001394.3-220s21c1
Sequence:CCGGGAAGCGGAGAGGAGATTCAAGCTCGAGCTTGAATCTCCTCTCCGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001394.3-270s21c1
Sequence:CCGGGGACGCCAAGAAACGCGATATCTCGAGATATCGCGTTTCTTGGCGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001394.3-391s21c1
Sequence:CCGGGACGTCTTCAGGGAGTTCTTCCTCGAGGAAGAACTCCCTGAAGACGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180971    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001394.2-273s1c1
Sequence:CCGGCGCCAAGAAACGCGATATCTACTCGAGTAGATATCGCGTTTCTTGGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)