EMAIL THIS PAGE TO A FRIEND

DNAJC16

DnaJ (Hsp40) homolog, subfamily C, member 16

125 Gene Product Result for
UniProtKB ID: Q9Y2G8, Q68D57, Q86X32, Q8N5P4
Gene ID:
Mouse(214063) DnaJ (Hsp40) homolog, subfamily C, member 16
Rat(362652) DnaJ (Hsp40) homolog, subfamily C, member 16
naked mole-rat(101706750) DnaJ (Hsp40) homolog, subfamily C, member 16
domestic guinea pig(100733328) DnaJ (Hsp40) homolog, subfamily C, member 16
sheep(101110690) DnaJ (Hsp40) homolog, subfamily C, member 16
Domestic Rabbit(100349545) DnaJ (Hsp40) homolog, subfamily C, member 16
Zebrafish(559762) DnaJ (Hsp40) homolog, subfamily C, member 16
cow(514510) DnaJ (Hsp40) homolog, subfamily C, member 16
Horse(100050591) DnaJ (Hsp40) homolog, subfamily C, member 16
domestic cat(101081481) DnaJ (Hsp40) homolog, subfamily C, member 16
dog(487431) DnaJ (Hsp40) homolog, subfamily C, member 16
chicken(429208) DnaJ (Hsp40) homolog, subfamily C, member 16
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015291 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015291 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015291 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_497656 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_497656 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_497656 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172338 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172338 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172338 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015291 Rosetta Predictions human pricing
NM_001014194 Rosetta Predictions rat pricing
NM_172338 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015291 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00347477 predicted 1441
2 SASI_Hs01_00134040 predicted 832
3 SASI_Hs01_00134041 predicted 684
4 SASI_Hs02_00347478 predicted 1535
5 SASI_Hs01_00134044 predicted 802
6 SASI_Hs01_00134045 predicted 2153
7 SASI_Hs01_00134046 predicted 2021
8 SASI_Hs01_00134047 predicted 2534
9 SASI_Hs02_00347479 predicted 767
10 SASI_Hs02_00347480 predicted 436
11 SASI_Hs01_00134042 predicted 1147
12 SASI_Hs01_00134043 predicted 2555
13 SASI_Hs01_00134048 predicted 2118
14 SASI_Hs01_00134049 predicted 2334
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014194 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00111409 predicted 1645
2 SASI_Rn01_00111411 predicted 1832
3 SASI_Rn01_00111413 predicted 1832
4 SASI_Rn01_00111414 predicted 1246
5 SASI_Rn01_00111415 predicted 271
6 SASI_Rn02_00201710 predicted 738
7 SASI_Rn01_00111416 predicted 1699
8 SASI_Rn01_00111417 predicted 2085
9 SASI_Rn01_00111418 predicted 2106
10 SASI_Rn02_00201711 predicted 2147
11 SASI_Rn01_00111410 predicted 1340
12 SASI_Rn01_00111412 predicted 1600
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172338 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00148585 predicted 296
2 SASI_Mm01_00148586 predicted 493
3 SASI_Mm01_00148587 predicted 801
4 SASI_Mm01_00148588 predicted 816
5 SASI_Mm01_00148590 predicted 342
6 SASI_Mm01_00148591 predicted 2470
7 SASI_Mm01_00148592 predicted 998
8 SASI_Mm01_00148593 predicted 2113
9 SASI_Mm01_00148594 predicted 2122
10 SASI_Mm02_00343817 predicted 1645
11 SASI_Mm01_00148589 predicted 1970
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015291
VALIDATED
DNAJC16 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily C, member 16
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000298265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_015291.2-316s21c1
Sequence:CCGGGCAGAAGACAAGTTCATTCAACTCGAGTTGAATGAACTTGTCTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_015291.2-1562s21c1
Sequence:CCGGATCTCGACCAGCTGCGTAAAGCTCGAGCTTTACGCAGCTGGTCGAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_015291.2-346s21c1
Sequence:CCGGGCTTACGAGATTCTTTCAAATCTCGAGATTTGAAAGAATCTCGTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_015291.2-767s21c1
Sequence:CCGGCCTCTATCCTAGGAATCATTACTCGAGTAATGATTCCTAGGATAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_015291.2-2192s21c1
Sequence:CCGGAGCGTGACTACACTGGTTATGCTCGAGCATAACCAGTGTAGTCACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015291.2-991s21c1
Sequence:CCGGGCCTTTGCATACAAAGATTATCTCGAGATAATCTTTGTATGCAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015291
VALIDATED
DNAJC16 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily C, member 16
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000298265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_015291.2-316s21c1
Sequence:CCGGGCAGAAGACAAGTTCATTCAACTCGAGTTGAATGAACTTGTCTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_015291.2-1562s21c1
Sequence:CCGGATCTCGACCAGCTGCGTAAAGCTCGAGCTTTACGCAGCTGGTCGAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_015291.2-346s21c1
Sequence:CCGGGCTTACGAGATTCTTTCAAATCTCGAGATTTGAAAGAATCTCGTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_015291.2-767s21c1
Sequence:CCGGCCTCTATCCTAGGAATCATTACTCGAGTAATGATTCCTAGGATAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_015291.2-2192s21c1
Sequence:CCGGAGCGTGACTACACTGGTTATGCTCGAGCATAACCAGTGTAGTCACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015291.2-991s21c1
Sequence:CCGGGCCTTTGCATACAAAGATTATCTCGAGATAATCTTTGTATGCAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015291
VALIDATED
DNAJC16 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily C, member 16
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000298265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_015291.2-316s21c1
Sequence:CCGGGCAGAAGACAAGTTCATTCAACTCGAGTTGAATGAACTTGTCTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_015291.2-1562s21c1
Sequence:CCGGATCTCGACCAGCTGCGTAAAGCTCGAGCTTTACGCAGCTGGTCGAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_015291.2-346s21c1
Sequence:CCGGGCTTACGAGATTCTTTCAAATCTCGAGATTTGAAAGAATCTCGTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_015291.2-767s21c1
Sequence:CCGGCCTCTATCCTAGGAATCATTACTCGAGTAATGATTCCTAGGATAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_015291.2-2192s21c1
Sequence:CCGGAGCGTGACTACACTGGTTATGCTCGAGCATAACCAGTGTAGTCACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015291.2-991s21c1
Sequence:CCGGGCCTTTGCATACAAAGATTATCTCGAGATAATCTTTGTATGCAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_497656
VALIDATED
DNAJC16 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily C, member 16
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:XM_497656.1-1498s1c1
Sequence:CCGGGCCTTTGCATACAAAGATTATCTCGAGATAATCTTTGTATGCAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497656.1-853s1c1
Sequence:CCGGGCTTACGAGATTCTTTCAAATCTCGAGATTTGAAAGAATCTCGTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:XM_497656.1-2532s1c1
Sequence:CCGGCCACATGAATGTGGTCCTCATCTCGAGATGAGGACCACATTCATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:XM_497656.1-823s1c1
Sequence:CCGGGCAGAAGACAAGTTCATTCAACTCGAGTTGAATGAACTTGTCTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497656.1-1652s1c1
Sequence:CCGGCCCGAGGTATGAAGAAGCAAACTCGAGTTTGCTTCTTCATACCTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_497656
VALIDATED
DNAJC16 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily C, member 16
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:XM_497656.1-1498s1c1
Sequence:CCGGGCCTTTGCATACAAAGATTATCTCGAGATAATCTTTGTATGCAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497656.1-853s1c1
Sequence:CCGGGCTTACGAGATTCTTTCAAATCTCGAGATTTGAAAGAATCTCGTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:XM_497656.1-2532s1c1
Sequence:CCGGCCACATGAATGTGGTCCTCATCTCGAGATGAGGACCACATTCATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:XM_497656.1-823s1c1
Sequence:CCGGGCAGAAGACAAGTTCATTCAACTCGAGTTGAATGAACTTGTCTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497656.1-1652s1c1
Sequence:CCGGCCCGAGGTATGAAGAAGCAAACTCGAGTTTGCTTCTTCATACCTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_497656
VALIDATED
DNAJC16 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily C, member 16
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:XM_497656.1-1498s1c1
Sequence:CCGGGCCTTTGCATACAAAGATTATCTCGAGATAATCTTTGTATGCAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497656.1-853s1c1
Sequence:CCGGGCTTACGAGATTCTTTCAAATCTCGAGATTTGAAAGAATCTCGTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:XM_497656.1-2532s1c1
Sequence:CCGGCCACATGAATGTGGTCCTCATCTCGAGATGAGGACCACATTCATGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:XM_497656.1-823s1c1
Sequence:CCGGGCAGAAGACAAGTTCATTCAACTCGAGTTGAATGAACTTGTCTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497656.1-1652s1c1
Sequence:CCGGCCCGAGGTATGAAGAAGCAAACTCGAGTTTGCTTCTTCATACCTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172338
DNAJC16 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily C, member 16
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112200    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172338.1-3222s1c1
Sequence:CCGGCCTGTGATCTTGTTCTCTGAACTCGAGTTCAGAGAACAAGATCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172338.1-2069s1c1
Sequence:CCGGGCTGGAGTATTTGCTAGAGTTCTCGAGAACTCTAGCAAATACTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172338.1-329s1c1
Sequence:CCGGGAGGACAAACTACGACCACTACTCGAGTAGTGGTCGTAGTTTGTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172338.1-1014s1c1
Sequence:CCGGCAGTACAACGTCAACCTCTATCTCGAGATAGAGGTTGACGTTGTACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172338.1-939s1c1
Sequence:CCGGGCCTTCGCATACAAGGATTATCTCGAGATAATCCTTGTATGCGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172338
DNAJC16 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily C, member 16
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112200    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172338.1-3222s1c1
Sequence:CCGGCCTGTGATCTTGTTCTCTGAACTCGAGTTCAGAGAACAAGATCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172338.1-2069s1c1
Sequence:CCGGGCTGGAGTATTTGCTAGAGTTCTCGAGAACTCTAGCAAATACTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172338.1-329s1c1
Sequence:CCGGGAGGACAAACTACGACCACTACTCGAGTAGTGGTCGTAGTTTGTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172338.1-1014s1c1
Sequence:CCGGCAGTACAACGTCAACCTCTATCTCGAGATAGAGGTTGACGTTGTACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172338.1-939s1c1
Sequence:CCGGGCCTTCGCATACAAGGATTATCTCGAGATAATCCTTGTATGCGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172338
DNAJC16 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily C, member 16
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112200    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172338.1-3222s1c1
Sequence:CCGGCCTGTGATCTTGTTCTCTGAACTCGAGTTCAGAGAACAAGATCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172338.1-2069s1c1
Sequence:CCGGGCTGGAGTATTTGCTAGAGTTCTCGAGAACTCTAGCAAATACTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172338.1-329s1c1
Sequence:CCGGGAGGACAAACTACGACCACTACTCGAGTAGTGGTCGTAGTTTGTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172338.1-1014s1c1
Sequence:CCGGCAGTACAACGTCAACCTCTATCTCGAGATAGAGGTTGACGTTGTACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172338.1-939s1c1
Sequence:CCGGGCCTTCGCATACAAGGATTATCTCGAGATAATCCTTGTATGCGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)