EMAIL THIS PAGE TO A FRIEND

DNASE2B

deoxyribonuclease II beta

65 Gene Product Result for
Synonyms: DLAD
UniProtKB ID: Q8WZ79, Q5VXD0, Q5VXD1, Q8WZ80, Q9NQW3
Gene ID:
Human(58511) Summary: The protein encoded by this gene shares considerable sequence similarity to, and is structurally related to DNase II. The latter is a well characterized endonuclease that catalyzes DNA hydrolysis in the absence of divalent cations at acidic pH. Unlike DNase II which is ubiquitously expressed, expression of this gene product is restricted to the salivary gland and lungs. The gene has been localized to chromosome 1p22.3 adjacent (and in opposite orientation) to the uricase pseudogene. Two transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
Mouse(56629) deoxyribonuclease II beta
Rat(59296) deoxyribonuclease II beta
sheep(101110100) deoxyribonuclease II beta
domestic guinea pig(100732795) deoxyribonuclease II beta
naked mole-rat(101719320) deoxyribonuclease II beta
chicken(424540) deoxyribonuclease II beta
domestic cat(101097005) deoxyribonuclease II beta
cow(525117) deoxyribonuclease II beta
Horse(100064895) deoxyribonuclease II beta
dog(479973) deoxyribonuclease II beta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2100608 Anti-DNASE2B (ab1) antibody produced in rabbit affinity isolated antibody rabbit, bovine, horse, human, guinea pig
western blot pricing
SAB2100609 Anti-DNASE2B (ab2) antibody produced in rabbit affinity isolated antibody mouse, human, horse, bovine, guinea pig, rat
western blot pricing
SAB2100610 Anti-DNASE2B (ab3) antibody produced in rabbit affinity isolated antibody human, bovine, guinea pig, horse
western blot pricing
AV42595 Anti-DNASE2B antibody produced in rabbit IgG fraction of antiserum guinea pig, horse, rat, human, mouse, bovine
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019957 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019957 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019957 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021233 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021233 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021233 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021233 Rosetta Predictions human pricing
NM_058248 Rosetta Predictions human pricing
NM_021664 Rosetta Predictions rat pricing
NM_019957 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021233 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00232132 predicted 554
2 SASI_Hs01_00232133 predicted 940
3 SASI_Hs01_00232134 predicted 811
4 SASI_Hs01_00232136 predicted 799
5 SASI_Hs01_00232137 predicted 872
6 SASI_Hs01_00232138 predicted 984
7 SASI_Hs01_00232140 predicted 822
8 SASI_Hs02_00354869 predicted 555
9 SASI_Hs01_00232141 predicted 629
10 SASI_Hs02_00354870 predicted 551
11 SASI_Hs01_00232135 predicted 845
12 SASI_Hs01_00232139 predicted 926
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_058248 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00021150 predicted 643
2 SASI_Hs01_00021151 predicted 550
3 SASI_Hs01_00021152 predicted 691
4 SASI_Hs02_00362149 predicted 550
5 SASI_Hs01_00021154 predicted 618
6 SASI_Hs01_00021156 predicted 571
7 SASI_Hs01_00021157 predicted 658
8 SASI_Hs02_00362150 predicted 661
9 SASI_Hs01_00021159 predicted 539
10 SASI_Hs02_00362151 predicted 781
11 SASI_Hs01_00021153 predicted 601
12 SASI_Hs01_00021155 predicted 774
13 SASI_Hs01_00021158 predicted 626
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021664 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00100282 predicted 439
2 SASI_Rn01_00100283 predicted 1060
3 SASI_Rn01_00100284 predicted 559
4 SASI_Rn01_00100285 predicted 1156
5 SASI_Rn01_00100286 predicted 501
6 SASI_Rn01_00100287 predicted 1204
7 SASI_Rn02_00262673 predicted 915
8 SASI_Rn01_00100290 predicted 933
9 SASI_Rn01_00100291 predicted 1143
10 SASI_Rn02_00262674 predicted 225
11 SASI_Rn01_00100288 predicted 644
12 SASI_Rn01_00100289 predicted 1044
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019957 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00185562 predicted 342
2 SASI_Mm01_00185563 predicted 733
3 SASI_Mm01_00185564 predicted 1341
4 SASI_Mm01_00185565 predicted 1303
5 SASI_Mm01_00185566 predicted 868
6 SASI_Mm01_00185567 predicted 603
7 SASI_Mm01_00185569 predicted 536
8 SASI_Mm01_00185570 predicted 1088
9 SASI_Mm02_00325250 predicted 764
10 SASI_Mm02_00325251 predicted 581
11 SASI_Mm01_00185568 predicted 1089
12 SASI_Mm01_00185571 predicted 1380
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019957
DNASE2B MISSION shRNA Bacterial Glycerol Stock
deoxyribonuclease II beta
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000203578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019957.2-2203s1c1
Sequence:CCGGGCCTAGTATAATAGAGGTCTACTCGAGTAGACCTCTATTATACTAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019957.2-599s1c1
Sequence:CCGGCATCTGTATGACACACATAATCTCGAGATTATGTGTGTCATACAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202712    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019957.2-2204s1c1
Sequence:CCGGCCTAGTATAATAGAGGTCTATCTCGAGATAGACCTCTATTATACTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203095    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019957.2-1814s1c1
Sequence:CCGGGCTGGTTTATAGTTTAGTCTTCTCGAGAAGACTAAACTATAAACCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019957.2-819s1c1
Sequence:CCGGGCATCTGCATCACTTTCGGATCTCGAGATCCGAAAGTGATGCAGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019957
DNASE2B MISSION shRNA shRNA Plasmid DNA
deoxyribonuclease II beta
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000203578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019957.2-2203s1c1
Sequence:CCGGGCCTAGTATAATAGAGGTCTACTCGAGTAGACCTCTATTATACTAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019957.2-599s1c1
Sequence:CCGGCATCTGTATGACACACATAATCTCGAGATTATGTGTGTCATACAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202712    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019957.2-2204s1c1
Sequence:CCGGCCTAGTATAATAGAGGTCTATCTCGAGATAGACCTCTATTATACTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000203095    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019957.2-1814s1c1
Sequence:CCGGGCTGGTTTATAGTTTAGTCTTCTCGAGAAGACTAAACTATAAACCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019957.2-819s1c1
Sequence:CCGGGCATCTGCATCACTTTCGGATCTCGAGATCCGAAAGTGATGCAGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019957
DNASE2B MISSION shRNA Lentiviral Transduction Particles
deoxyribonuclease II beta
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000203578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019957.2-2203s1c1
Sequence:CCGGGCCTAGTATAATAGAGGTCTACTCGAGTAGACCTCTATTATACTAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019957.2-599s1c1
Sequence:CCGGCATCTGTATGACACACATAATCTCGAGATTATGTGTGTCATACAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202712    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019957.2-2204s1c1
Sequence:CCGGCCTAGTATAATAGAGGTCTATCTCGAGATAGACCTCTATTATACTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203095    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019957.2-1814s1c1
Sequence:CCGGGCTGGTTTATAGTTTAGTCTTCTCGAGAAGACTAAACTATAAACCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019957.2-819s1c1
Sequence:CCGGGCATCTGCATCACTTTCGGATCTCGAGATCCGAAAGTGATGCAGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021233
DNASE2B MISSION shRNA Bacterial Glycerol Stock
deoxyribonuclease II beta
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021233.2-115s1c1
Sequence:CCGGGCAACAATTTCATGCAGAAATCTCGAGATTTCTGCATGAAATTGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021233.2-371s1c1
Sequence:CCGGGAGTCCCTAAACCTGTGAATTCTCGAGAATTCACAGGTTTAGGGACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021233.2-264s1c1
Sequence:CCGGGCAACTAATGAATGACACCAACTCGAGTTGGTGTCATTCATTAGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021233.2-1075s1c1
Sequence:CCGGCAAGCATTTCAAGGATTAGTACTCGAGTACTAATCCTTGAAATGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021233.2-877s1c1
Sequence:CCGGCCTTACCATGTCTACAATATACTCGAGTATATTGTAGACATGGTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021233.2-944s21c1
Sequence:CCGGATCATGCCAAGTGGTGTATTTCTCGAGAAATACACCACTTGGCATGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021233.2-299s21c1
Sequence:CCGGGGACATTACAACAGCTATATGCTCGAGCATATAGCTGTTGTAATGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021233.2-444s21c1
Sequence:CCGGAGGGTTCTGGCTGATTCATTCCTCGAGGAATGAATCAGCCAGAACCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021233
DNASE2B MISSION shRNA shRNA Plasmid DNA
deoxyribonuclease II beta
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021233.2-115s1c1
Sequence:CCGGGCAACAATTTCATGCAGAAATCTCGAGATTTCTGCATGAAATTGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021233.2-371s1c1
Sequence:CCGGGAGTCCCTAAACCTGTGAATTCTCGAGAATTCACAGGTTTAGGGACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021233.2-264s1c1
Sequence:CCGGGCAACTAATGAATGACACCAACTCGAGTTGGTGTCATTCATTAGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021233.2-1075s1c1
Sequence:CCGGCAAGCATTTCAAGGATTAGTACTCGAGTACTAATCCTTGAAATGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021233.2-877s1c1
Sequence:CCGGCCTTACCATGTCTACAATATACTCGAGTATATTGTAGACATGGTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021233.2-944s21c1
Sequence:CCGGATCATGCCAAGTGGTGTATTTCTCGAGAAATACACCACTTGGCATGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021233.2-299s21c1
Sequence:CCGGGGACATTACAACAGCTATATGCTCGAGCATATAGCTGTTGTAATGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021233.2-444s21c1
Sequence:CCGGAGGGTTCTGGCTGATTCATTCCTCGAGGAATGAATCAGCCAGAACCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021233
DNASE2B MISSION shRNA Lentiviral Transduction Particles
deoxyribonuclease II beta
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021233.2-115s1c1
Sequence:CCGGGCAACAATTTCATGCAGAAATCTCGAGATTTCTGCATGAAATTGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021233.2-371s1c1
Sequence:CCGGGAGTCCCTAAACCTGTGAATTCTCGAGAATTCACAGGTTTAGGGACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021233.2-264s1c1
Sequence:CCGGGCAACTAATGAATGACACCAACTCGAGTTGGTGTCATTCATTAGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021233.2-1075s1c1
Sequence:CCGGCAAGCATTTCAAGGATTAGTACTCGAGTACTAATCCTTGAAATGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021233.2-877s1c1
Sequence:CCGGCCTTACCATGTCTACAATATACTCGAGTATATTGTAGACATGGTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021233.2-944s21c1
Sequence:CCGGATCATGCCAAGTGGTGTATTTCTCGAGAAATACACCACTTGGCATGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021233.2-299s21c1
Sequence:CCGGGGACATTACAACAGCTATATGCTCGAGCATATAGCTGTTGTAATGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021233.2-444s21c1
Sequence:CCGGAGGGTTCTGGCTGATTCATTCCTCGAGGAATGAATCAGCCAGAACCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)