EMAIL THIS PAGE TO A FRIEND

DPEP2

dipeptidase 2

81 Gene Product Result for
Synonyms: MBD2
UniProtKB ID: Q9H4A9, B2RCF8, Q6UX92, Q8TC95
Gene ID:
Human(64174) Summary: DPEP2 belongs to the membrane-bound dipeptidase (EC 3.4.13.19) family. These enzymes hydrolyze a variety of dipeptides, including leukotriene D4, the beta-lactam ring of some antibiotics, and cystinyl-bis-glycine (cys-bis-gly) formed during glutathione degradation (Habib et al., 2003 [PubMed 12738806]
Mouse(319446) dipeptidase 2
Rat(291984) dipeptidase 2
sheep(101110863) dipeptidase 2
chicken(415714) dipeptidase 2
domestic cat(101091578) dipeptidase 2
cow(539370) dipeptidase 2
Horse(100066437) dipeptidase 2
dog(611083) dipeptidase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022355 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022355 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022355 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_176913 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_176913 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_176913 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU074111 MISSION® esiRNA esiRNA human DPEP2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022355 Rosetta Predictions human pricing
NM_001011928 Rosetta Predictions rat pricing
XM_574232 Rosetta Predictions rat pricing
NM_176913 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022355 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00067754 predicted 1057
2 SASI_Hs01_00067755 predicted 640
3 SASI_Hs01_00067756 predicted 1074
4 SASI_Hs01_00067757 predicted 1454
5 SASI_Hs01_00067758 predicted 1055
6 SASI_Hs01_00067759 predicted 694
7 SASI_Hs01_00067760 predicted 850
8 SASI_Hs01_00067761 predicted 890
9 SASI_Hs01_00067762 predicted 630
10 SASI_Hs01_00067763 predicted 1143
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011928 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00101835 predicted 1079
2 SASI_Rn01_00101838 predicted 765
3 SASI_Rn02_00199930 predicted 345
4 SASI_Rn01_00101839 predicted 1106
5 SASI_Rn01_00101840 predicted 630
6 SASI_Rn01_00101841 predicted 360
7 SASI_Rn02_00199931 predicted 613
8 SASI_Rn01_00101843 predicted 401
9 SASI_Rn01_00101844 predicted 448
10 SASI_Rn02_00199932 predicted 576
11 SASI_Rn01_00101836 predicted 1151
12 SASI_Rn01_00101837 predicted 566
13 SASI_Rn01_00101842 predicted 791
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574232 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00133596 predicted 1006
2 SASI_Rn01_00133597 predicted 987
3 SASI_Rn01_00133598 predicted 981
4 SASI_Rn01_00133599 predicted 1002
5 SASI_Rn01_00133600 predicted 944
6 SASI_Rn01_00133601 predicted 634
7 SASI_Rn01_00133602 predicted 22
8 SASI_Rn01_00133603 predicted 1290
9 SASI_Rn01_00133604 predicted 968
10 SASI_Rn01_00133605 predicted 490
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176913 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00121932 predicted 1309
2 SASI_Mm01_00121933 predicted 770
3 SASI_Mm01_00121934 predicted 543
4 SASI_Mm01_00121935 predicted 458
5 SASI_Mm01_00121936 predicted 1372
6 SASI_Mm01_00121937 predicted 540
7 SASI_Mm01_00121938 predicted 380
8 SASI_Mm01_00121939 predicted 600
9 SASI_Mm01_00121940 predicted 739
10 SASI_Mm01_00121941 predicted 738
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022355
DPEP2 MISSION shRNA Bacterial Glycerol Stock
dipeptidase 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022355.1-205s1c1
Sequence:CCGGCCAGCCTGTAACCTGTGCCTACTCGAGTAGGCACAGGTTACAGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022355.2-1157s21c1
Sequence:CCGGGATCCAAGTTCATCGGGATTGCTCGAGCAATCCCGATGAACTTGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022355.1-881s1c1
Sequence:CCGGCTGGGCATGATGGTAGACTTACTCGAGTAAGTCTACCATCATGCCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022355.1-811s1c1
Sequence:CCGGCCACTCCTTCTACAACAACATCTCGAGATGTTGTTGTAGAAGGAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022355.1-1069s1c1
Sequence:CCGGCATGGGAGTAATACAGTGCAACTCGAGTTGCACTGTATTACTCCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022355.1-644s1c1
Sequence:CCGGGCTCTGAACGACACTCAGAAACTCGAGTTTCTGAGTGTCGTTCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022355.2-996s21c1
Sequence:CCGGGTGCAACAGTGCTCGGAATGTCTCGAGACATTCCGAGCACTGTTGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022355
DPEP2 MISSION shRNA shRNA Plasmid DNA
dipeptidase 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022355.1-205s1c1
Sequence:CCGGCCAGCCTGTAACCTGTGCCTACTCGAGTAGGCACAGGTTACAGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022355.2-1157s21c1
Sequence:CCGGGATCCAAGTTCATCGGGATTGCTCGAGCAATCCCGATGAACTTGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022355.1-881s1c1
Sequence:CCGGCTGGGCATGATGGTAGACTTACTCGAGTAAGTCTACCATCATGCCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022355.1-811s1c1
Sequence:CCGGCCACTCCTTCTACAACAACATCTCGAGATGTTGTTGTAGAAGGAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022355.1-1069s1c1
Sequence:CCGGCATGGGAGTAATACAGTGCAACTCGAGTTGCACTGTATTACTCCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022355.1-644s1c1
Sequence:CCGGGCTCTGAACGACACTCAGAAACTCGAGTTTCTGAGTGTCGTTCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022355.2-996s21c1
Sequence:CCGGGTGCAACAGTGCTCGGAATGTCTCGAGACATTCCGAGCACTGTTGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022355
DPEP2 MISSION shRNA Lentiviral Transduction Particles
dipeptidase 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022355.1-205s1c1
Sequence:CCGGCCAGCCTGTAACCTGTGCCTACTCGAGTAGGCACAGGTTACAGGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022355.2-1157s21c1
Sequence:CCGGGATCCAAGTTCATCGGGATTGCTCGAGCAATCCCGATGAACTTGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022355.1-881s1c1
Sequence:CCGGCTGGGCATGATGGTAGACTTACTCGAGTAAGTCTACCATCATGCCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022355.1-811s1c1
Sequence:CCGGCCACTCCTTCTACAACAACATCTCGAGATGTTGTTGTAGAAGGAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022355.1-1069s1c1
Sequence:CCGGCATGGGAGTAATACAGTGCAACTCGAGTTGCACTGTATTACTCCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022355.1-644s1c1
Sequence:CCGGGCTCTGAACGACACTCAGAAACTCGAGTTTCTGAGTGTCGTTCAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022355.2-996s21c1
Sequence:CCGGGTGCAACAGTGCTCGGAATGTCTCGAGACATTCCGAGCACTGTTGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176913
DPEP2 MISSION shRNA Bacterial Glycerol Stock
dipeptidase 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176913.3-1056s1c1
Sequence:CCGGCGCTTAGGTATGATGGTTGATCTCGAGATCAACCATCATACCTAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176913.3-774s1c1
Sequence:CCGGGCCTCTTATTCTGAGCTGGAACTCGAGTTCCAGCTCAGAATAAGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176913.3-210s1c1
Sequence:CCGGCCTCGCCTGAAATTGAAGCATCTCGAGATGCTTCAATTTCAGGCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176913.3-1370s1c1
Sequence:CCGGCATCGGAATTGGCGGAGATTACTCGAGTAATCTCCGCCAATTCCGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176913.3-1264s1c1
Sequence:CCGGGCAACCCTTTAGCCAATGTATCTCGAGATACATTGGCTAAAGGGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176913
DPEP2 MISSION shRNA shRNA Plasmid DNA
dipeptidase 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176913.3-1056s1c1
Sequence:CCGGCGCTTAGGTATGATGGTTGATCTCGAGATCAACCATCATACCTAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176913.3-774s1c1
Sequence:CCGGGCCTCTTATTCTGAGCTGGAACTCGAGTTCCAGCTCAGAATAAGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176913.3-210s1c1
Sequence:CCGGCCTCGCCTGAAATTGAAGCATCTCGAGATGCTTCAATTTCAGGCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176913.3-1370s1c1
Sequence:CCGGCATCGGAATTGGCGGAGATTACTCGAGTAATCTCCGCCAATTCCGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176913.3-1264s1c1
Sequence:CCGGGCAACCCTTTAGCCAATGTATCTCGAGATACATTGGCTAAAGGGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176913
DPEP2 MISSION shRNA Lentiviral Transduction Particles
dipeptidase 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176913.3-1056s1c1
Sequence:CCGGCGCTTAGGTATGATGGTTGATCTCGAGATCAACCATCATACCTAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176913.3-774s1c1
Sequence:CCGGGCCTCTTATTCTGAGCTGGAACTCGAGTTCCAGCTCAGAATAAGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176913.3-210s1c1
Sequence:CCGGCCTCGCCTGAAATTGAAGCATCTCGAGATGCTTCAATTTCAGGCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176913.3-1370s1c1
Sequence:CCGGCATCGGAATTGGCGGAGATTACTCGAGTAATCTCCGCCAATTCCGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176913.3-1264s1c1
Sequence:CCGGGCAACCCTTTAGCCAATGTATCTCGAGATACATTGGCTAAAGGGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)