EMAIL THIS PAGE TO A FRIEND

DPRX

divergent-paired related homeobox

21 Gene Product Result for
UniProtKB ID: A6NFQ7
Gene ID:
Human(503834) Summary: Homeobox genes encode DNA-binding proteins, many of which are thought to be involved in early embryonic development. Homeobox genes encode a DNA-binding domain of 60 to 63 amino acids referred to as the homeodomain. This gene is a member of the DPRX homeobox gene family. Evidence of mRNA expression has not yet been found for this gene. Multiple, related processed pseudogenes have been found which are thought to reflect expression of this gene in the germ line or embryonic cells. [provided by RefSeq, Jul 2008]
dog(611533) divergent-paired related homeobox
domestic cat(101085419) divergent-paired related homeobox
Horse(100063186) divergent-paired related homeobox
domestic guinea pig(101787812) divergent-paired related homeobox
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001012728 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001012728 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001012728 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012728 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012728 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224573 predicted 398
2 SASI_Hs01_00224574 predicted 263
3 SASI_Hs01_00224578 predicted 219
4 SASI_Hs02_00306230 predicted 380
5 SASI_Hs02_00306231 predicted 390
6 SASI_Hs02_00306232 predicted 384
7 SASI_Hs02_00306233 predicted 257
8 SASI_Hs02_00306234 predicted 393
9 SASI_Hs02_00306235 predicted 374
10 SASI_Hs01_00224575 predicted 397
11 SASI_Hs01_00224576 predicted 223
12 SASI_Hs01_00224577 predicted 370
13 SASI_Hs01_00224579 predicted 305
14 SASI_Hs01_00224580 predicted 236
15 SASI_Hs01_00224581 predicted 373
16 SASI_Hs01_00224582 predicted 335
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012728
DPRX MISSION shRNA Bacterial Glycerol Stock
divergent-paired related homeobox
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012728.1-139s1c1
Sequence:CCGGGATCTGAACATCTTGTTCAATCTCGAGATTGAACAAGATGTTCAGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012728.1-87s1c1
Sequence:CCGGCCAGATGCATTCACACAGGAACTCGAGTTCCTGTGTGAATGCATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012728.1-352s1c1
Sequence:CCGGCTGAGAAATGCAGACACACTACTCGAGTAGTGTGTCTGCATTTCTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012728.1-301s1c1
Sequence:CCGGGAAACTCCACAACCGCCAATACTCGAGTATTGGCGGTTGTGGAGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012728.1-187s1c1
Sequence:CCGGCAGAAAGAAATGGCCTCGAAACTCGAGTTTCGAGGCCATTTCTTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012728
DPRX MISSION shRNA shRNA Plasmid DNA
divergent-paired related homeobox
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012728.1-139s1c1
Sequence:CCGGGATCTGAACATCTTGTTCAATCTCGAGATTGAACAAGATGTTCAGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012728.1-87s1c1
Sequence:CCGGCCAGATGCATTCACACAGGAACTCGAGTTCCTGTGTGAATGCATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012728.1-352s1c1
Sequence:CCGGCTGAGAAATGCAGACACACTACTCGAGTAGTGTGTCTGCATTTCTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012728.1-301s1c1
Sequence:CCGGGAAACTCCACAACCGCCAATACTCGAGTATTGGCGGTTGTGGAGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012728.1-187s1c1
Sequence:CCGGCAGAAAGAAATGGCCTCGAAACTCGAGTTTCGAGGCCATTTCTTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012728
DPRX MISSION shRNA Lentiviral Transduction Particles
divergent-paired related homeobox
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012728.1-139s1c1
Sequence:CCGGGATCTGAACATCTTGTTCAATCTCGAGATTGAACAAGATGTTCAGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012728.1-87s1c1
Sequence:CCGGCCAGATGCATTCACACAGGAACTCGAGTTCCTGTGTGAATGCATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012728.1-352s1c1
Sequence:CCGGCTGAGAAATGCAGACACACTACTCGAGTAGTGTGTCTGCATTTCTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012728.1-301s1c1
Sequence:CCGGGAAACTCCACAACCGCCAATACTCGAGTATTGGCGGTTGTGGAGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012728.1-187s1c1
Sequence:CCGGCAGAAAGAAATGGCCTCGAAACTCGAGTTTCGAGGCCATTTCTTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)