EMAIL THIS PAGE TO A FRIEND

DRAM2

DNA-damage regulated autophagy modulator 2

115 Gene Product Result for
Synonyms: PRO180 RP5-1180E21.1 TMEM77 WWFQ154
UniProtKB ID: Q6UX65, B3SUG9, Q4VWF6, Q86VD3, Q8NBQ4
Gene ID:
Mouse(67171) DNA-damage regulated autophagy modulator 2
Rat(362011) DNA-damage regulated autophagy modulator 2
naked mole-rat(101722576) DNA-damage regulated autophagy modulator 2
domestic guinea pig(100723780) DNA-damage regulated autophagy modulator 2
sheep(101112523) DNA-damage regulated autophagy modulator 2
chicken(421151) DNA-damage regulated autophagy modulator 2
domestic cat(101093200) DNA-damage regulated autophagy modulator 2
dog(479905) DNA-damage regulated autophagy modulator 2
cow(767922) DNA-damage regulated autophagy modulator 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178454 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178454 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178454 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026013 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026013 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026013 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178454 Rosetta Predictions human pricing
NM_001025018 Rosetta Predictions rat pricing
NM_001025582 Rosetta Predictions mouse pricing
NM_026013 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178454 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126184 predicted 849
2 SASI_Hs01_00126185 predicted 885
3 SASI_Hs01_00126187 predicted 1013
4 SASI_Hs01_00126188 predicted 685
5 SASI_Hs01_00126189 predicted 981
6 SASI_Hs02_00369682 predicted 551
7 SASI_Hs01_00126190 predicted 857
8 SASI_Hs01_00126191 predicted 341
9 SASI_Hs01_00126192 predicted 349
10 SASI_Hs02_00369683 predicted 882
11 SASI_Hs01_00126186 predicted 652
12 SASI_Hs01_00126193 predicted 438
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025018 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00049355 predicted 550
2 SASI_Rn01_00049356 predicted 590
3 SASI_Rn02_00202931 predicted 1117
4 SASI_Rn01_00049357 predicted 409
5 SASI_Rn02_00202932 predicted 969
6 SASI_Rn01_00049359 predicted 1146
7 SASI_Rn01_00049362 predicted 643
8 SASI_Rn02_00202933 predicted 856
9 SASI_Rn01_00049363 predicted 522
10 SASI_Rn01_00049364 predicted 415
11 SASI_Rn01_00049358 predicted 398
12 SASI_Rn01_00049360 predicted 1077
13 SASI_Rn01_00049361 predicted 565
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025582 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00036807 predicted 952
2 SASI_Mm01_00036809 predicted 291
3 SASI_Mm02_00287930 predicted 943
4 SASI_Mm01_00036812 predicted 1020
5 SASI_Mm01_00036808 predicted 803
6 SASI_Mm01_00036810 predicted 295
7 SASI_Mm01_00036811 predicted 307
8 SASI_Mm02_00287931 predicted 440
9 SASI_Mm01_00036814 predicted 437
10 SASI_Mm01_00036815 predicted 598
11 SASI_Mm01_00036813 predicted 370
12 SASI_Mm01_00036816 predicted 696
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026013 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00022855 predicted 1213
2 SASI_Mm01_00022857 predicted 293
3 SASI_Mm02_00329480 predicted 1028
4 SASI_Mm02_00329481 predicted 1210
5 SASI_Mm01_00022860 predicted 1279
6 SASI_Mm01_00022858 predicted 296
7 SASI_Mm01_00022859 predicted 301
8 SASI_Mm01_00022862 predicted 433
9 SASI_Mm01_00022863 predicted 861
10 SASI_Mm01_00022864 predicted 951
11 SASI_Mm01_00022856 predicted 1061
12 SASI_Mm01_00022861 predicted 373
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178454
VALIDATED
DRAM2 MISSION shRNA Bacterial Glycerol Stock
DNA-damage regulated autophagy modulator 2
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434921    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178454.4-1207s21c1
Sequence:CCGGAGAAGCCATTTGATAGATTATCTCGAGATAATCTATCAAATGGCTTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178454.4-674s21c1
Sequence:CCGGGACCATCCTTTCCTACCAAATCTCGAGATTTGGTAGGAAAGGATGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178454.4-365s21c1
Sequence:CCGGAGACCCGGCTTTACCTTATATCTCGAGATATAAGGTAAAGCCGGGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178454.4-926s21c1
Sequence:CCGGCCTGACTTACATTCGTGATTTCTCGAGAAATCACGAATGTAAGTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_178454.1-409s1c1
Sequence:CCGGCGGGTGGAAGCCAATTTACATCTCGAGATGTAAATTGGCTTCCACCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_178454.1-479s1c1
Sequence:CCGGCACGGCTACTTTCCAGAGATACTCGAGTATCTCTGGAAAGTAGCCGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_178454.1-481s1c1
Sequence:CCGGCGGCTACTTTCCAGAGATATTCTCGAGAATATCTCTGGAAAGTAGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_178454.1-415s1c1
Sequence:CCGGGAAGCCAATTTACATGGATTACTCGAGTAATCCATGTAAATTGGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_178454.1-265s1c1
Sequence:CCGGGATTTAGAACAGAAACTCCATCTCGAGATGGAGTTTCTGTTCTAAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_178454.1-458s1c1
Sequence:CCGGGCCCTATTAACAATGAACGAACTCGAGTTCGTTCATTGTTAATAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_178454.1-454s1c1
Sequence:CCGGCCTTGCCCTATTAACAATGAACTCGAGTTCATTGTTAATAGGGCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160550    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178454.1-300s1c1
Sequence:CCGGCAAAGGTTATGTGCTTCACATCTCGAGATGTGAAGCACATAACCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_178454.1-209s1c1
Sequence:CCGGGTGCACTTAGCATGCTGACTTCTCGAGAAGTCAGCATGCTAAGTGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178454
VALIDATED
DRAM2 MISSION shRNA shRNA Plasmid DNA
DNA-damage regulated autophagy modulator 2
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434921    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178454.4-1207s21c1
Sequence:CCGGAGAAGCCATTTGATAGATTATCTCGAGATAATCTATCAAATGGCTTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178454.4-674s21c1
Sequence:CCGGGACCATCCTTTCCTACCAAATCTCGAGATTTGGTAGGAAAGGATGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178454.4-365s21c1
Sequence:CCGGAGACCCGGCTTTACCTTATATCTCGAGATATAAGGTAAAGCCGGGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178454.4-926s21c1
Sequence:CCGGCCTGACTTACATTCGTGATTTCTCGAGAAATCACGAATGTAAGTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_178454.1-409s1c1
Sequence:CCGGCGGGTGGAAGCCAATTTACATCTCGAGATGTAAATTGGCTTCCACCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_178454.1-479s1c1
Sequence:CCGGCACGGCTACTTTCCAGAGATACTCGAGTATCTCTGGAAAGTAGCCGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_178454.1-481s1c1
Sequence:CCGGCGGCTACTTTCCAGAGATATTCTCGAGAATATCTCTGGAAAGTAGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_178454.1-415s1c1
Sequence:CCGGGAAGCCAATTTACATGGATTACTCGAGTAATCCATGTAAATTGGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_178454.1-265s1c1
Sequence:CCGGGATTTAGAACAGAAACTCCATCTCGAGATGGAGTTTCTGTTCTAAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_178454.1-458s1c1
Sequence:CCGGGCCCTATTAACAATGAACGAACTCGAGTTCGTTCATTGTTAATAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_178454.1-454s1c1
Sequence:CCGGCCTTGCCCTATTAACAATGAACTCGAGTTCATTGTTAATAGGGCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160550    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178454.1-300s1c1
Sequence:CCGGCAAAGGTTATGTGCTTCACATCTCGAGATGTGAAGCACATAACCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_178454.1-209s1c1
Sequence:CCGGGTGCACTTAGCATGCTGACTTCTCGAGAAGTCAGCATGCTAAGTGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178454
VALIDATED
DRAM2 MISSION shRNA Lentiviral Transduction Particles
DNA-damage regulated autophagy modulator 2
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434921    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178454.4-1207s21c1
Sequence:CCGGAGAAGCCATTTGATAGATTATCTCGAGATAATCTATCAAATGGCTTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178454.4-674s21c1
Sequence:CCGGGACCATCCTTTCCTACCAAATCTCGAGATTTGGTAGGAAAGGATGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178454.4-365s21c1
Sequence:CCGGAGACCCGGCTTTACCTTATATCTCGAGATATAAGGTAAAGCCGGGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178454.4-926s21c1
Sequence:CCGGCCTGACTTACATTCGTGATTTCTCGAGAAATCACGAATGTAAGTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_178454.1-409s1c1
Sequence:CCGGCGGGTGGAAGCCAATTTACATCTCGAGATGTAAATTGGCTTCCACCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_178454.1-479s1c1
Sequence:CCGGCACGGCTACTTTCCAGAGATACTCGAGTATCTCTGGAAAGTAGCCGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_178454.1-481s1c1
Sequence:CCGGCGGCTACTTTCCAGAGATATTCTCGAGAATATCTCTGGAAAGTAGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_178454.1-415s1c1
Sequence:CCGGGAAGCCAATTTACATGGATTACTCGAGTAATCCATGTAAATTGGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_178454.1-265s1c1
Sequence:CCGGGATTTAGAACAGAAACTCCATCTCGAGATGGAGTTTCTGTTCTAAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_178454.1-458s1c1
Sequence:CCGGGCCCTATTAACAATGAACGAACTCGAGTTCGTTCATTGTTAATAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_178454.1-454s1c1
Sequence:CCGGCCTTGCCCTATTAACAATGAACTCGAGTTCATTGTTAATAGGGCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160550    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178454.1-300s1c1
Sequence:CCGGCAAAGGTTATGTGCTTCACATCTCGAGATGTGAAGCACATAACCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_178454.1-209s1c1
Sequence:CCGGGTGCACTTAGCATGCTGACTTCTCGAGAAGTCAGCATGCTAAGTGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026013
VALIDATED
DRAM2 MISSION shRNA Bacterial Glycerol Stock
DNA-damage regulated autophagy modulator 2
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215707    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026013.2-1344s1c1
Sequence:CCGGCTTGGCCTTAAACATATTATTCTCGAGAATAATATGTTTAAGGCCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216187    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026013.2-398s1c1
Sequence:CCGGCTTTGGAGTAATGCTAAATATCTCGAGATATTTAGCATTACTCCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026013.2-474s21c1
Sequence:CCGGCTGAACCCTGAAGAGAACCTTCTCGAGAAGGTTCTCTTCAGGGTTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026013.2-450s21c1
Sequence:CCGGGTTCGTTACAAGCAAGTTCATCTCGAGATGAACTTGCTTGTAACGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026013.2-825s21c1
Sequence:CCGGGAGGACAAAGGCTATGTGCTTCTCGAGAAGCACATAGCCTTTGTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026013.2-748s21c1
Sequence:CCGGGCATGATGACTTGCTCATCAACTCGAGTTGATGAGCAAGTCATCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026013.1-771s1c1
Sequence:CCGGGAGGACAAAGGCTATGTGCTTCTCGAGAAGCACATAGCCTTTGTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026013.1-420s1c1
Sequence:CCGGCTGAACCCTGAAGAGAACCTTCTCGAGAAGGTTCTCTTCAGGGTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026013.1-396s1c1
Sequence:CCGGGTTCGTTACAAGCAAGTTCATCTCGAGATGAACTTGCTTGTAACGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026013.1-694s1c1
Sequence:CCGGGCATGATGACTTGCTCATCAACTCGAGTTGATGAGCAAGTCATCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197824    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026013.1-240s1c1
Sequence:CCGGGCTACCTTCATATTCTCATATCTCGAGATATGAGAATATGAAGGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026013
VALIDATED
DRAM2 MISSION shRNA shRNA Plasmid DNA
DNA-damage regulated autophagy modulator 2
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215707    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026013.2-1344s1c1
Sequence:CCGGCTTGGCCTTAAACATATTATTCTCGAGAATAATATGTTTAAGGCCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216187    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026013.2-398s1c1
Sequence:CCGGCTTTGGAGTAATGCTAAATATCTCGAGATATTTAGCATTACTCCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026013.2-474s21c1
Sequence:CCGGCTGAACCCTGAAGAGAACCTTCTCGAGAAGGTTCTCTTCAGGGTTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026013.2-450s21c1
Sequence:CCGGGTTCGTTACAAGCAAGTTCATCTCGAGATGAACTTGCTTGTAACGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026013.2-825s21c1
Sequence:CCGGGAGGACAAAGGCTATGTGCTTCTCGAGAAGCACATAGCCTTTGTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026013.2-748s21c1
Sequence:CCGGGCATGATGACTTGCTCATCAACTCGAGTTGATGAGCAAGTCATCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026013.1-771s1c1
Sequence:CCGGGAGGACAAAGGCTATGTGCTTCTCGAGAAGCACATAGCCTTTGTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026013.1-420s1c1
Sequence:CCGGCTGAACCCTGAAGAGAACCTTCTCGAGAAGGTTCTCTTCAGGGTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026013.1-396s1c1
Sequence:CCGGGTTCGTTACAAGCAAGTTCATCTCGAGATGAACTTGCTTGTAACGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026013.1-694s1c1
Sequence:CCGGGCATGATGACTTGCTCATCAACTCGAGTTGATGAGCAAGTCATCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197824    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026013.1-240s1c1
Sequence:CCGGGCTACCTTCATATTCTCATATCTCGAGATATGAGAATATGAAGGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026013
VALIDATED
DRAM2 MISSION shRNA Lentiviral Transduction Particles
DNA-damage regulated autophagy modulator 2
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215707    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026013.2-1344s1c1
Sequence:CCGGCTTGGCCTTAAACATATTATTCTCGAGAATAATATGTTTAAGGCCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216187    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026013.2-398s1c1
Sequence:CCGGCTTTGGAGTAATGCTAAATATCTCGAGATATTTAGCATTACTCCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026013.2-474s21c1
Sequence:CCGGCTGAACCCTGAAGAGAACCTTCTCGAGAAGGTTCTCTTCAGGGTTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026013.2-450s21c1
Sequence:CCGGGTTCGTTACAAGCAAGTTCATCTCGAGATGAACTTGCTTGTAACGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026013.2-825s21c1
Sequence:CCGGGAGGACAAAGGCTATGTGCTTCTCGAGAAGCACATAGCCTTTGTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026013.2-748s21c1
Sequence:CCGGGCATGATGACTTGCTCATCAACTCGAGTTGATGAGCAAGTCATCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026013.1-771s1c1
Sequence:CCGGGAGGACAAAGGCTATGTGCTTCTCGAGAAGCACATAGCCTTTGTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026013.1-420s1c1
Sequence:CCGGCTGAACCCTGAAGAGAACCTTCTCGAGAAGGTTCTCTTCAGGGTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026013.1-396s1c1
Sequence:CCGGGTTCGTTACAAGCAAGTTCATCTCGAGATGAACTTGCTTGTAACGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026013.1-694s1c1
Sequence:CCGGGCATGATGACTTGCTCATCAACTCGAGTTGATGAGCAAGTCATCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197824    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026013.1-240s1c1
Sequence:CCGGGCTACCTTCATATTCTCATATCTCGAGATATGAGAATATGAAGGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)