EMAIL THIS PAGE TO A FRIEND

Drd1a

13 Gene Product Result for
Species: Mouse Drd1a(13488)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Precursor

Product # Description Species Add to Cart
 
D9503 3,4-Dihydroxy-DL-phenylalanine human, mouse, rat pricing
D9628 3,4-Dihydroxy-L-phenylalanine ≥98% (TLC) human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010076 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010076 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010076 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_010076 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010076 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317758 predicted 1098
2 SASI_Mm01_00195562 predicted 1274
3 SASI_Mm01_00195563 predicted 700
4 SASI_Mm01_00195564 predicted 712
5 SASI_Mm01_00195565 predicted 1171
6 SASI_Mm01_00195566 predicted 1299
7 SASI_Mm01_00195567 predicted 955
8 SASI_Mm01_00195569 predicted 1451
9 SASI_Mm01_00195570 predicted 1852
10 SASI_Mm01_00195571 predicted 854
11 SASI_Mm01_00195568 predicted 945
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010076
Drd1a MISSION shRNA Bacterial Glycerol Stock
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028369    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010076.1-2822s1c1
Sequence:CCGGCCCTGTCATTTCTCATTTCATCTCGAGATGAAATGAGAAATGACAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010076.1-1152s1c1
Sequence:CCGGCGTCACTTACACCAGTATCTACTCGAGTAGATACTGGTGTAAGTGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010076.1-1664s1c1
Sequence:CCGGCCAAGGACTGTAATCTGGTTTCTCGAGAAACCAGATTACAGTCCTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010076.1-1544s1c1
Sequence:CCGGCGACCCTCTTAGGATGCTATACTCGAGTATAGCATCCTAAGAGGGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010076.1-934s1c1
Sequence:CCGGGCCTTCATCCTGATTAGCGTACTCGAGTACGCTAATCAGGATGAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010076.3-1566s21c1
Sequence:CCGGCTCTGCCCTACAACGAATAATCTCGAGATTATTCGTTGTAGGGCAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010076.3-1140s21c1
Sequence:CCGGGCCATTATGATCGTCACTTACCTCGAGGTAAGTGACGATCATAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236746    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010076.3-2035s21c1
Sequence:CCGGTATCTTAGGACACTCTATATACTCGAGTATATAGAGTGTCCTAAGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010076.3-1770s21c1
Sequence:CCGGCCGGCCTTATCGGTCATATTGCTCGAGCAATATGACCGATAAGGCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010076.3-1445s21c1
Sequence:GTACCGGTTCCATCACCTTCGATGTATTCTCGAGAATACATCGAAGGTGATGGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010076
Drd1a MISSION shRNA shRNA Plasmid DNA
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028369    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010076.1-2822s1c1
Sequence:CCGGCCCTGTCATTTCTCATTTCATCTCGAGATGAAATGAGAAATGACAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010076.1-1152s1c1
Sequence:CCGGCGTCACTTACACCAGTATCTACTCGAGTAGATACTGGTGTAAGTGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010076.1-1664s1c1
Sequence:CCGGCCAAGGACTGTAATCTGGTTTCTCGAGAAACCAGATTACAGTCCTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010076.1-1544s1c1
Sequence:CCGGCGACCCTCTTAGGATGCTATACTCGAGTATAGCATCCTAAGAGGGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010076.1-934s1c1
Sequence:CCGGGCCTTCATCCTGATTAGCGTACTCGAGTACGCTAATCAGGATGAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010076.3-1566s21c1
Sequence:CCGGCTCTGCCCTACAACGAATAATCTCGAGATTATTCGTTGTAGGGCAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010076.3-1140s21c1
Sequence:CCGGGCCATTATGATCGTCACTTACCTCGAGGTAAGTGACGATCATAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236746    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010076.3-2035s21c1
Sequence:CCGGTATCTTAGGACACTCTATATACTCGAGTATATAGAGTGTCCTAAGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010076.3-1770s21c1
Sequence:CCGGCCGGCCTTATCGGTCATATTGCTCGAGCAATATGACCGATAAGGCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010076.3-1445s21c1
Sequence:GTACCGGTTCCATCACCTTCGATGTATTCTCGAGAATACATCGAAGGTGATGGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010076
Drd1a MISSION shRNA Lentiviral Transduction Particles
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028369    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010076.1-2822s1c1
Sequence:CCGGCCCTGTCATTTCTCATTTCATCTCGAGATGAAATGAGAAATGACAGGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010076.1-1152s1c1
Sequence:CCGGCGTCACTTACACCAGTATCTACTCGAGTAGATACTGGTGTAAGTGACGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010076.1-1664s1c1
Sequence:CCGGCCAAGGACTGTAATCTGGTTTCTCGAGAAACCAGATTACAGTCCTTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010076.1-1544s1c1
Sequence:CCGGCGACCCTCTTAGGATGCTATACTCGAGTATAGCATCCTAAGAGGGTCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010076.1-934s1c1
Sequence:CCGGGCCTTCATCCTGATTAGCGTACTCGAGTACGCTAATCAGGATGAAGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010076.3-1566s21c1
Sequence:CCGGCTCTGCCCTACAACGAATAATCTCGAGATTATTCGTTGTAGGGCAGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010076.3-1140s21c1
Sequence:CCGGGCCATTATGATCGTCACTTACCTCGAGGTAAGTGACGATCATAATGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236746    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010076.3-2035s21c1
Sequence:CCGGTATCTTAGGACACTCTATATACTCGAGTATATAGAGTGTCCTAAGATATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010076.3-1770s21c1
Sequence:CCGGCCGGCCTTATCGGTCATATTGCTCGAGCAATATGACCGATAAGGCCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010076.3-1445s21c1
Sequence:GTACCGGTTCCATCACCTTCGATGTATTCTCGAGAATACATCGAAGGTGATGGAATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)