EMAIL THIS PAGE TO A FRIEND

DRD2

dopamine receptor D2

237 Gene Product Result for
Synonyms: D2DR D2R
UniProtKB ID: P14416, Q9NZR3, Q9UPA9
Gene ID:
Human(1813) Summary: This gene encodes the D2 subtype of the dopamine receptor. This G-protein coupled receptor inhibits adenylyl cyclase activity. A missense mutation in this gene causes myoclonus dystonia; other mutations have been associated with schizophrenia. Alternative splicing of this gene results in two transcript variants encoding different isoforms. A third variant has been described, but it has not been determined whether this form is normal or due to aberrant splicing. [provided by RefSeq, Jul 2008]
Mouse(13489) dopamine receptor D2
Rat(24318) dopamine receptor D2
chicken(428252) dopamine receptor D2
dog(403701) dopamine receptor D2
cow(281126) dopamine receptor D2
Horse(100062195) dopamine receptor D2
domestic cat(101096838) dopamine receptor D2
sheep(101113525) dopamine receptor D2
Domestic Rabbit(100347371) dopamine receptor D2
domestic guinea pig(100732584) dopamine receptor D2
naked mole-rat(101711462) dopamine receptor D2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4301831 Anti-DRD2 affinity isolated antibody human
immunohistochemistry pricing
SAB1403744 Monoclonal Anti-DRD2, (N-terminal) antibody produced in mouse clone 1B11, ascites fluid human
ELISA, western blot pricing

Small Molecule - Agonist

Product # Description Species Add to Cart
 
P105 (±)-PPHT hydrochloride ≥98% (HPLC), solid human pricing
Q111 (±)-Quinpirole dihydrochloride powder human pricing
Q102 (−)-Quinpirole hydrochloride ≥98% (HPLC), solid human pricing
B2134 2-Bromo-α-ergocryptine methanesulfonate salt solid human pricing
1041008 Apomorphine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
Y0001465 Apomorphine hydrochloride hemihydrate European Pharmacopoeia (EP) Reference Standard human pricing
A-119 Aripiprazole solution 1.0 mg/mL (50:50 Methanol/Water with 1% 1N HCl), ampule of 1 mL, certified reference material, Cerilliant® human pricing
SML1670 Bifeprunox mesylate ≥98% (HPLC) human pricing
C0246 Cabergoline ≥98% (HPLC) human pricing
Y0000472 Cabergoline European Pharmacopoeia (EP) Reference Standard human pricing
1084306 Cabergoline United States Pharmacopeia (USP) Reference Standard human pricing
D2763 Dihydroergotamine methanesulfonate salt powder human pricing
M9292 Memantine hydrochloride ≥98% (GC) human pricing
Y0000010 Pergolide mesilate European Pharmacopoeia (EP) Reference Standard human pricing
1510845 Pergolide mesylate United States Pharmacopeia (USP) Reference Standard human pricing
A1237 Pramipexole dihydrochloride >98% (HPLC), powder human pricing
P102 R(+)-3-(3-Hydroxyphenyl)-N-propylpiperidine hydrochloride solid human pricing
A4393 R-(−)-Apomorphine hydrochloride hemihydrate calcined, ≥98.5% human pricing
Y0001775 Ropinirole for peak identification 1 European Pharmacopoeia (EP) Reference Standard human pricing
Y0001776 Ropinirole for peak identification 2 European Pharmacopoeia (EP) Reference Standard human pricing
Y0002019 Ropinirole for peak identification 3 European Pharmacopoeia (EP) Reference Standard human pricing
R2530 Ropinirole hydrochloride powder, ≥98% (HPLC) human pricing
Y0001773 Ropinirole hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
1605205 Ropinirole hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
PHR1633 Ropinirole Hydrochloride Pharmaceutical Secondary Standard; Certified Reference Material human pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
S8010 (±)-Sulpiride human pricing
D033 (+)-Butaclamol hydrochloride human pricing
H-076 9-Hydroxyrisperidone solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
A129 Amoxapine human pricing
A-123 Amoxapine 1.0 mg/mL in methanol, certified reference material, Cerilliant® human pricing
PHR1841 Amoxapine Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1031401 Amoxapine United States Pharmacopeia (USP) Reference Standard human pricing
A-101 Asenapine maleate solution 1.0 mg/mL in methanol (as free base), ampule of 1 mL, certified reference material, Cerilliant® human pricing
B1152000 Bromperidol European Pharmacopoeia (EP) Reference Standard human pricing
C8138 Chlorpromazine hydrochloride ≥98% (TLC) human pricing
C0982 Chlorpromazine hydrochloride meets USP testing specifications human pricing
31679 Chlorpromazine hydrochloride VETRANAL®, analytical standard human pricing
1125006 Chlorpromazine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
C1900000 Chlorpromazine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
BP856 Chlorpromazine hydrochloride British Pharmacopoeia (BP) Reference Standard human pricing
285374 Chlorpromazine hydrochloride 98% human pricing
C-904 Chlorpromazine hydrochloride solution 1.0 mg/mL in methanol (as free base), ampule of 1 mL, certified reference material, Cerilliant® human pricing
C1671 Chlorprothixene hydrochloride human pricing
C1915000 Chlorprothixene hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
F114 cis-(Z)-Flupenthixol dihydrochloride ≥98% (HPLC), solid human pricing
BP905 Clozapine British Pharmacopoeia (BP) Reference Standard human pricing
C2460000 Clozapine European Pharmacopoeia (EP) Reference Standard human pricing
1142107 Clozapine United States Pharmacopeia (USP) Reference Standard human pricing
Y0000758 Clozapine for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
1142108 Clozapine Resolution Mixture United States Pharmacopeia (USP) Reference Standard human pricing
C-059 Clozapine solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
D1414 Droperidol human pricing
D3100000 Droperidol European Pharmacopoeia (EP) Reference Standard human pricing
BP675 Droperidol British Pharmacopoeia (BP) Reference Standard human pricing
1229001 Droperidol United States Pharmacopeia (USP) Reference Standard human pricing
F4429 FAUC 213 ≥98% (HPLC), solid human pricing
F4765 Fluphenazine dihydrochloride human pricing
F0280000 Fluphenazine dihydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
F-903 Fluphenazine dihydrochloride solution 1.0 mg/mL in methanol (as free base), ampule of 1 mL, certified reference material, Cerilliant® human pricing
BP167 Fluphenazine hydrochloride British Pharmacopoeia (BP) Reference Standard human pricing
1282004 Fluphenazine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
PHR1792 Fluphenazine Hydrochloride Pharmaceutical Secondary Standard; Certified Reference Material human pricing
F100 Fluspirilene human pricing
SML1528 Iloperidone ≥98% (HPLC) human pricing
1336249 Iloperidone United States Pharmacopeia (USP) Reference Standard human pricing
I-011 Iloperidone solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
L135 L-741,626 ≥98% (HPLC) human pricing
1370702 Loxapine succinate United States Pharmacopeia (USP) Reference Standard human pricing
L106 Loxapine succinate salt solid human pricing
SML2069 Lurasidone hydrochloride ≥98% (HPLC) human pricing
L-030 Lurasidone hydrochloride solution 1.0 mg/mL in methanol (as free base), ampule of 1 mL, certified reference material, Cerilliant® human pricing
M4068 Mesoridazine benzenesulfonate ≥98% (HPLC), powder human pricing
BP496 Mesoridazine besilate British Pharmacopoeia (BP) Reference Standard human pricing
1393005 Mesoridazine besylate United States Pharmacopeia (USP) Reference Standard human pricing
32473 Metoclopramide VETRANAL®, analytical standard human pricing
M1824990 Metoclopramide European Pharmacopoeia (EP) Reference Standard human pricing
M0763 Metoclopramide hydrochloride solid human pricing
BP357 Metoclopramide hydrochloride British Pharmacopoeia (BP) Reference Standard human pricing
1445459 Molindone hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
M1818 Molindone hydrochloride ≥98% (HPLC), solid human pricing
O111 Octoclothepin maleate salt solid human pricing
PHR1825 Olanzapine Pharmaceutical Secondary Standard; Certified Reference Material human pricing
O1141 Olanzapine ≥98% (HPLC) human pricing
1478301 Olanzapine United States Pharmacopeia (USP) Reference Standard human pricing
BP1060 Olanzapine British Pharmacopoeia (BP) Reference Standard human pricing
Y0001370 Olanzapine European Pharmacopoeia (EP) Reference Standard human pricing
Y0001380 Olanzapine for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
O-024 Olanzapine solution 1.0 mg/mL in acetonitrile, ampule of 1 mL, certified reference material, Cerilliant® human pricing
P0099 Paliperidone ≥98% (HPLC) human pricing
1491809 Paliperidone United States Pharmacopeia (USP) Reference Standard human pricing
P6402 Perphenazine human pricing
P0550000 Perphenazine European Pharmacopoeia (EP) Reference Standard human pricing
BP422 Perphenazine British Pharmacopoeia (BP) Reference Standard human pricing
1511000 Perphenazine United States Pharmacopeia (USP) Reference Standard human pricing
Y0001045 Perphenazine for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
BP682 Pimozide British Pharmacopoeia (BP) Reference Standard human pricing
1539508 Pimozide United States Pharmacopeia (USP) Reference Standard human pricing
P1750000 Pimozide European Pharmacopoeia (EP) Reference Standard human pricing
P9178 Prochlorperazine dimaleate salt human pricing
1566001 Prochlorperazine maleate United States Pharmacopeia (USP) Reference Standard human pricing
BP638 Prochlorperazine maleate British Pharmacopoeia (BP) Reference Standard human pricing
P3200000 Prochlorperazine maleate European Pharmacopoeia (EP) Reference Standard human pricing
P6656 Promazine hydrochloride human pricing
1569000 Promazine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
46674 Promazine hydrochloride VETRANAL®, analytical standard human pricing
P3390000 Promazine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
P7780 Propionylpromazine hydrochloride human pricing
Y0001419 Quetiapine for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
1592704 Quetiapine fumarate United States Pharmacopeia (USP) Reference Standard, monograph mol wt. 883.09 ((C21H25N3O2S)2 · C4H4O4) human pricing
Y0001657 Quetiapine fumarate European Pharmacopoeia (EP) Reference Standard human pricing
PHR1856 Quetiapine Fumarate Pharmaceutical Secondary Standard; Certified Reference Material human pricing
Q-001 Quetiapine fumarate solution 1.0 mg/mL in methanol (as free base), ampule of 1 mL, certified reference material, Cerilliant® human pricing
Q3638 Quetiapine hemifumarate salt ≥98% (HPLC) human pricing
PHR1631 Risperidone Pharmaceutical Secondary Standard; Certified Reference Material human pricing
R3030 Risperidone ≥98% (HPLC), powder human pricing
1604654 Risperidone United States Pharmacopeia (USP) Reference Standard human pricing
BP1137 Risperidone British Pharmacopoeia (BP) Reference Standard human pricing
R1000600 Risperidone European Pharmacopoeia (EP) Reference Standard human pricing
Y0000370 Risperidone for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
BP1158 Risperidone impurity standard British Pharmacopoeia (BP) Reference Standard human pricing
R-006 Risperidone solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
R121 S(−)-Raclopride (+)-tartrate salt >97%, solid human pricing
E101 S-(−)-Eticlopride hydrochloride ≥98% (HPLC), powder human pricing
S8072 Sertindole ≥97.5% (HPLC) human pricing
T9025 Thioridazine hydrochloride ≥99% human pricing
1663008 Thioridazine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
T1300000 Thioridazine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
T-905 Thioridazine solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1665003 Thiothixene United States Pharmacopeia (USP) Reference Standard human pricing
T8516 Trifluoperazine dihydrochloride ≥99%, powder human pricing
T-117 Trifluoperazine dihydrochloride solution 1.0 mg/mL in methanol (as free base), ampule of 1 mL, certified reference material, Cerilliant® human pricing
T6062 Trifluoperazine hydrochloride meets USP testing specifications human pricing
1685000 Trifluoperazine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
T2000000 Trifluoperazine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
T103 Trifluperidol hydrochloride human pricing
46976 Triflupromazine hydrochloride VETRANAL®, analytical standard human pricing
1686003 Triflupromazine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
T-904 Trimipramine solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
Y0001272 Ziprasidone for system suitability 1 European Pharmacopoeia (EP) Reference Standard human pricing
Y0001241 Ziprasidone for system suitability 2 European Pharmacopoeia (EP) Reference Standard human pricing
1724408 Ziprasidone hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
Y0001286 Ziprasidone hydrochloride monohydrate European Pharmacopoeia (EP) Reference Standard human pricing
547905 2,2′:5′,2′′:5′′,2′′′-Quaterthiophene 96% human, mouse, rat pricing
A0132 Atropine ≥99% (TLC), powder human, mouse, rat pricing
A2468 Atropine meets USP testing specifications human, mouse, rat pricing
M0443 Mirtazapine ≥98% (HPLC) human, mouse, rat pricing
P1793 Pimozide human, mouse, rat pricing
P127 (+)-Pentazocine solid human, rat pricing
E4250 (−)-Epinephrine human, rat pricing
A7257 (−)-Norepinephrine ≥98%, crystalline human, rat pricing
S7771 (S)-(−)-Sulpiride ≥98% (titration) human, rat pricing
M1626 6-Methoxyharmalan crystalline human, rat pricing
B9308 BP897 >98% (HPLC), solid human, rat pricing
C6305 Clozapine human, rat pricing
D122 Domperidone powder, ≥98% (HPLC) human, rat pricing
H1512 Haloperidol powder human, rat pricing
51330 Harmaline ≥95% human, rat pricing
L7007 Lysergic acid diethylamide human, rat pricing
R103 Ritanserin powder human, rat pricing
S0693 SB 204741 >98% (HPLC) human, rat pricing
S7395 Spiperone solid human, rat pricing
T104 Tropisetron monohydrochloride solid, ≥98% (HPLC) human, rat pricing
M22601 1-(2-Methoxyphenyl)piperazine 98% mouse, rat pricing
75475 1-Cyclohexylpiperazine ≥97.0% (GC) mouse, rat pricing
P30004 1-Phenylpiperazine 99% mouse, rat pricing
B162 B-HT 920 dihydrochloride solid, ≥98% (HPLC) rat pricing
T90344 Tyramine ≥98.0% rat pricing

Small Molecule - Ligand

Product # Description Species Add to Cart
 
C5270 Cinnarizine powder human pricing

Small Molecule - Precursor

Product # Description Species Add to Cart
 
D9503 3,4-Dihydroxy-DL-phenylalanine human, mouse, rat pricing
D9628 3,4-Dihydroxy-L-phenylalanine ≥98% (TLC) human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000795 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000795 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000795 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010077 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010077 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010077 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU074371 MISSION® esiRNA targeting human DRD2 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000795 Rosetta Predictions human pricing
NM_016574 Rosetta Predictions human pricing
NM_012547 Rosetta Predictions rat pricing
NM_010077 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000795 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092047 predicted 1406
2 SASI_Hs01_00092048 predicted 1260
3 SASI_Hs01_00092049 predicted 1354
4 SASI_Hs02_00303242 predicted 536
5 SASI_Hs01_00092050 predicted 327
6 SASI_Hs01_00092051 predicted 1339
7 SASI_Hs01_00092052 predicted 371
8 SASI_Hs01_00092053 predicted 548
9 SASI_Hs01_00092054 predicted 322
10 SASI_Hs01_00092056 predicted 1328
11 SASI_Hs01_00092055 predicted 303
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016574 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207534 predicted 1319
2 SASI_Hs01_00207535 predicted 1177
3 SASI_Hs01_00207536 predicted 1267
4 SASI_Hs02_00349703 predicted 538
5 SASI_Hs01_00207537 predicted 329
6 SASI_Hs01_00207538 predicted 1259
7 SASI_Hs01_00207539 predicted 363
8 SASI_Hs01_00207540 predicted 550
9 SASI_Hs01_00207541 predicted 326
10 SASI_Hs01_00207543 predicted 1248
11 SASI_Hs01_00207542 predicted 296
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012547 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00259629 predicted 794
2 SASI_Rn01_00051544 predicted 352
3 SASI_Rn01_00051546 predicted 1472
4 SASI_Rn02_00259630 predicted 1533
5 SASI_Rn01_00051547 predicted 1114
6 SASI_Rn01_00051548 predicted 1104
7 SASI_Rn01_00051549 predicted 857
8 SASI_Rn01_00051550 predicted 1341
9 SASI_Rn01_00051551 predicted 442
10 SASI_Rn01_00051552 predicted 598
11 SASI_Rn01_00051545 predicted 654
12 SASI_Rn01_00051553 predicted 1094
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010077 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00151159 predicted 546
2 SASI_Mm01_00151160 predicted 345
3 SASI_Mm01_00151161 predicted 405
4 SASI_Mm01_00151162 predicted 867
5 SASI_Mm01_00151163 predicted 1220
6 SASI_Mm01_00151164 predicted 853
7 SASI_Mm01_00151165 predicted 611
8 SASI_Mm02_00317759 predicted 237
9 SASI_Mm01_00151167 predicted 1086
10 SASI_Mm01_00151168 predicted 838
11 SASI_Mm01_00151166 predicted 229
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000795
DRD2 MISSION shRNA Bacterial Glycerol Stock
dopamine receptor D2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000795.3-996s21c1
Sequence:CCGGCCGTTATCATGAAGTCTAATGCTCGAGCATTAGACTTCATGATAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000795.3-1396s21c1
Sequence:CCGGGCCCTTCTTCATCACACACATCTCGAGATGTGTGTGATGAAGAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000795.3-741s21c1
Sequence:CCGGCACTCCTCTTCGGACTCAATACTCGAGTATTGAGTCCGAAGAGGAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000795.3-1513s21c1
Sequence:CCGGCACCACCTTCAACATTGAGTTCTCGAGAACTCAATGTTGAAGGTGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315421    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000795.3-2053s21c1
Sequence:CCGGGTCCTGGGAGACCCATGTAAACTCGAGTTTACATGGGTCTCCCAGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000795.2-923s1c1
Sequence:CCGGGCACCGTTATCATGAAGTCTACTCGAGTAGACTTCATGATAACGGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000795.2-1326s1c1
Sequence:CCGGGCCCTTCTTCATCACACACATCTCGAGATGTGTGTGATGAAGAAGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000795.2-1443s1c1
Sequence:CCGGCACCACCTTCAACATTGAGTTCTCGAGAACTCAATGTTGAAGGTGGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000795.2-783s1c1
Sequence:CCGGGCTGGTCTACATCAAGATCTACTCGAGTAGATCTTGATGTAGACCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011339    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000795.2-2246s1c1
Sequence:CCGGGTATCCCTTCTCACAGCACATCTCGAGATGTGCTGTGAGAAGGGATACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000795
DRD2 MISSION shRNA shRNA Plasmid DNA
dopamine receptor D2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000795.3-996s21c1
Sequence:CCGGCCGTTATCATGAAGTCTAATGCTCGAGCATTAGACTTCATGATAACGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000315419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000795.3-1396s21c1
Sequence:CCGGGCCCTTCTTCATCACACACATCTCGAGATGTGTGTGATGAAGAAGGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000315420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000795.3-741s21c1
Sequence:CCGGCACTCCTCTTCGGACTCAATACTCGAGTATTGAGTCCGAAGAGGAGTGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000350540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000795.3-1513s21c1
Sequence:CCGGCACCACCTTCAACATTGAGTTCTCGAGAACTCAATGTTGAAGGTGGTGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000315421    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000795.3-2053s21c1
Sequence:CCGGGTCCTGGGAGACCCATGTAAACTCGAGTTTACATGGGTCTCCCAGGACTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000011341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000795.2-923s1c1
Sequence:CCGGGCACCGTTATCATGAAGTCTACTCGAGTAGACTTCATGATAACGGTGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000011340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000795.2-1326s1c1
Sequence:CCGGGCCCTTCTTCATCACACACATCTCGAGATGTGTGTGATGAAGAAGGGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000011343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000795.2-1443s1c1
Sequence:CCGGCACCACCTTCAACATTGAGTTCTCGAGAACTCAATGTTGAAGGTGGTGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000011342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000795.2-783s1c1
Sequence:CCGGGCTGGTCTACATCAAGATCTACTCGAGTAGATCTTGATGTAGACCAGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000011339    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000795.2-2246s1c1
Sequence:CCGGGTATCCCTTCTCACAGCACATCTCGAGATGTGCTGTGAGAAGGGATACTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000795
DRD2 MISSION shRNA Lentiviral Transduction Particles
dopamine receptor D2
Human
10 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000350594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000795.3-996s21c1
Sequence:CCGGCCGTTATCATGAAGTCTAATGCTCGAGCATTAGACTTCATGATAACGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000795.3-1396s21c1
Sequence:CCGGGCCCTTCTTCATCACACACATCTCGAGATGTGTGTGATGAAGAAGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000795.3-741s21c1
Sequence:CCGGCACTCCTCTTCGGACTCAATACTCGAGTATTGAGTCCGAAGAGGAGTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000795.3-1513s21c1
Sequence:CCGGCACCACCTTCAACATTGAGTTCTCGAGAACTCAATGTTGAAGGTGGTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315421    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000795.3-2053s21c1
Sequence:CCGGGTCCTGGGAGACCCATGTAAACTCGAGTTTACATGGGTCTCCCAGGACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000795.2-923s1c1
Sequence:CCGGGCACCGTTATCATGAAGTCTACTCGAGTAGACTTCATGATAACGGTGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000795.2-1326s1c1
Sequence:CCGGGCCCTTCTTCATCACACACATCTCGAGATGTGTGTGATGAAGAAGGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000795.2-1443s1c1
Sequence:CCGGCACCACCTTCAACATTGAGTTCTCGAGAACTCAATGTTGAAGGTGGTGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000795.2-783s1c1
Sequence:CCGGGCTGGTCTACATCAAGATCTACTCGAGTAGATCTTGATGTAGACCAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011339    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000795.2-2246s1c1
Sequence:CCGGGTATCCCTTCTCACAGCACATCTCGAGATGTGCTGTGAGAAGGGATACTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010077
DRD2 MISSION shRNA Bacterial Glycerol Stock
dopamine receptor D2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010077.1-438s1c1
Sequence:CCGGCAGGATTCACTGTGACATCTTCTCGAGAAGATGTCACAGTGAATCCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010077.1-1135s1c1
Sequence:CCGGCCCAGGATTGCCAAGTTCTTTCTCGAGAAAGAACTTGGCAATCCTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010077.1-1260s1c1
Sequence:CCGGCATTGTTCTTGGTGTGTTCATCTCGAGATGAACACACCAAGAACAATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010077.1-661s1c1
Sequence:CCGGGACCAGAATGAGTGTATCATTCTCGAGAATGATACACTCATTCTGGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010077.1-225s1c1
Sequence:CCGGCCACTACAACTACTATGCCATCTCGAGATGGCATAGTAGTTGTAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010077
DRD2 MISSION shRNA shRNA Plasmid DNA
dopamine receptor D2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010077.1-438s1c1
Sequence:CCGGCAGGATTCACTGTGACATCTTCTCGAGAAGATGTCACAGTGAATCCTGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000025772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010077.1-1135s1c1
Sequence:CCGGCCCAGGATTGCCAAGTTCTTTCTCGAGAAAGAACTTGGCAATCCTGGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000025733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010077.1-1260s1c1
Sequence:CCGGCATTGTTCTTGGTGTGTTCATCTCGAGATGAACACACCAAGAACAATGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000025777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010077.1-661s1c1
Sequence:CCGGGACCAGAATGAGTGTATCATTCTCGAGAATGATACACTCATTCTGGTCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000025738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010077.1-225s1c1
Sequence:CCGGCCACTACAACTACTATGCCATCTCGAGATGGCATAGTAGTTGTAGTGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010077
DRD2 MISSION shRNA Lentiviral Transduction Particles
dopamine receptor D2
Mouse
5 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000025707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010077.1-438s1c1
Sequence:CCGGCAGGATTCACTGTGACATCTTCTCGAGAAGATGTCACAGTGAATCCTGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010077.1-1135s1c1
Sequence:CCGGCCCAGGATTGCCAAGTTCTTTCTCGAGAAAGAACTTGGCAATCCTGGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010077.1-1260s1c1
Sequence:CCGGCATTGTTCTTGGTGTGTTCATCTCGAGATGAACACACCAAGAACAATGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010077.1-661s1c1
Sequence:CCGGGACCAGAATGAGTGTATCATTCTCGAGAATGATACACTCATTCTGGTCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010077.1-225s1c1
Sequence:CCGGCCACTACAACTACTATGCCATCTCGAGATGGCATAGTAGTTGTAGTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)