EMAIL THIS PAGE TO A FRIEND

DRG1

developmentally regulated GTP binding protein 1

46 Gene Product Result for
Synonyms: NEDD3
UniProtKB ID: Q9Y295, B2RDS8, Q6FGP8, Q8WW69, Q9UGF2
Gene ID:
Mouse(13494) developmentally regulated GTP binding protein 1
Rat(305470) developmentally regulated GTP binding protein 1
Zebrafish(336823) developmentally regulated GTP binding protein 1
cow(540161) developmentally regulated GTP binding protein 1
Horse(100058335) developmentally regulated GTP binding protein 1
domestic cat(101098339) developmentally regulated GTP binding protein 1
chicken(416962) developmentally regulated GTP binding protein 1
Thale Cress(838320) developmentally regulated G-protein 1
dog(477543) developmentally regulated GTP binding protein 1
sheep(101115484) developmentally regulated GTP binding protein 1
Domestic Rabbit(100328730) developmentally regulated GTP binding protein 1
domestic guinea pig(100729958) developmentally regulated GTP binding protein 1
naked mole-rat(101700874) developmentally regulated GTP binding protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA001218 Anti-DRG1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, rat, mouse
immunohistochemistry, western blot pricing
AV48240 Anti-DRG1 antibody produced in rabbit affinity isolated antibody bovine, guinea pig, rabbit, mouse, horse, zebrafish, rabbit, human, rat
western blot pricing
SAB2103925 Anti-DRG1, (N-terminal) antibody produced in rabbit affinity isolated antibody rabbit, guinea pig, bovine, human, horse, rabbit, rat, mouse
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007879 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007879 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007879 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004147 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004147 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004147 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004147 Rosetta Predictions human pricing
NM_001009685 Rosetta Predictions rat pricing
NM_007879 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004147 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070233 predicted 880
2 SASI_Hs01_00070234 predicted 992
3 SASI_Hs01_00070235 predicted 890
4 SASI_Hs01_00070236 predicted 1023
5 SASI_Hs01_00070238 predicted 583
6 SASI_Hs02_00336996 predicted 982
7 SASI_Hs01_00070239 predicted 301
8 SASI_Hs01_00070241 predicted 861
9 SASI_Hs01_00070242 predicted 1084
10 SASI_Hs02_00336997 predicted 512
11 SASI_Hs01_00070237 predicted 328
12 SASI_Hs01_00070240 predicted 752
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009685 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00199738 predicted 775
2 SASI_Rn02_00199739 predicted 239
3 SASI_Rn02_00199740 predicted 658
4 SASI_Rn02_00199741 predicted 710
5 SASI_Rn02_00199742 predicted 751
6 SASI_Rn02_00199743 predicted 769
7 SASI_Rn02_00199744 predicted 909
8 SASI_Rn02_00199745 predicted 953
9 SASI_Rn02_00199746 predicted 743
10 SASI_Rn02_00199747 predicted 898
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007879 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00161640 predicted 803
2 SASI_Mm01_00161641 predicted 974
3 SASI_Mm01_00161642 predicted 940
4 SASI_Mm01_00161643 predicted 266
5 SASI_Mm01_00161644 predicted 690
6 SASI_Mm01_00161645 predicted 785
7 SASI_Mm01_00161646 predicted 934
8 SASI_Mm01_00161647 predicted 302
9 SASI_Mm01_00161648 predicted 828
10 SASI_Mm01_00161649 predicted 1095
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007879
VALIDATED
DRG1 MISSION shRNA Bacterial Glycerol Stock
developmentally regulated GTP binding protein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000327269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007879.1-538s21c1
Sequence:CCGGCTTGGGACATAAGAAGATAATCTCGAGATTATCTTCTTATGTCCCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007879.1-383s21c1
Sequence:CCGGCCTGGTGTCATCAGATATAAACTCGAGTTTATATCTGATGACACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306554    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007879.1-1270s21c1
Sequence:CCGGTTGGGATACAGGGATTGATATCTCGAGATATCAATCCCTGTATCCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007879.1-422s21c1
Sequence:CCGGCTGGATCTCCCGGGTATTATTCTCGAGAATAATACCCGGGAGATCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007879.1-837s21c1
Sequence:CCGGCCATTGAGGAGTTGGATATTACTCGAGTAATATCCAACTCCTCAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098035    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007879.1-1330s1c1
Sequence:CCGGCCGGAGATAGGGTGTTATGTACTCGAGTACATAACACCCTATCTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007879.1-383s1c1
Sequence:CCGGCCTGGTGTCATCAGATATAAACTCGAGTTTATATCTGATGACACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007879.1-975s1c1
Sequence:CCGGGCCAGTTACCAGATTACACATCTCGAGATGTGTAATCTGGTAACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007879.1-537s1c1
Sequence:CCGGCCTTGGGACATAAGAAGATAACTCGAGTTATCTTCTTATGTCCCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007879.1-538s1c1
Sequence:CCGGCTTGGGACATAAGAAGATAATCTCGAGATTATCTTCTTATGTCCCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007879
VALIDATED
DRG1 MISSION shRNA shRNA Plasmid DNA
developmentally regulated GTP binding protein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000327269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007879.1-538s21c1
Sequence:CCGGCTTGGGACATAAGAAGATAATCTCGAGATTATCTTCTTATGTCCCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007879.1-383s21c1
Sequence:CCGGCCTGGTGTCATCAGATATAAACTCGAGTTTATATCTGATGACACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306554    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007879.1-1270s21c1
Sequence:CCGGTTGGGATACAGGGATTGATATCTCGAGATATCAATCCCTGTATCCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007879.1-422s21c1
Sequence:CCGGCTGGATCTCCCGGGTATTATTCTCGAGAATAATACCCGGGAGATCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007879.1-837s21c1
Sequence:CCGGCCATTGAGGAGTTGGATATTACTCGAGTAATATCCAACTCCTCAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098035    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007879.1-1330s1c1
Sequence:CCGGCCGGAGATAGGGTGTTATGTACTCGAGTACATAACACCCTATCTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007879.1-383s1c1
Sequence:CCGGCCTGGTGTCATCAGATATAAACTCGAGTTTATATCTGATGACACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007879.1-975s1c1
Sequence:CCGGGCCAGTTACCAGATTACACATCTCGAGATGTGTAATCTGGTAACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007879.1-537s1c1
Sequence:CCGGCCTTGGGACATAAGAAGATAACTCGAGTTATCTTCTTATGTCCCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007879.1-538s1c1
Sequence:CCGGCTTGGGACATAAGAAGATAATCTCGAGATTATCTTCTTATGTCCCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007879
VALIDATED
DRG1 MISSION shRNA Lentiviral Transduction Particles
developmentally regulated GTP binding protein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000327269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007879.1-538s21c1
Sequence:CCGGCTTGGGACATAAGAAGATAATCTCGAGATTATCTTCTTATGTCCCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007879.1-383s21c1
Sequence:CCGGCCTGGTGTCATCAGATATAAACTCGAGTTTATATCTGATGACACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306554    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007879.1-1270s21c1
Sequence:CCGGTTGGGATACAGGGATTGATATCTCGAGATATCAATCCCTGTATCCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007879.1-422s21c1
Sequence:CCGGCTGGATCTCCCGGGTATTATTCTCGAGAATAATACCCGGGAGATCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007879.1-837s21c1
Sequence:CCGGCCATTGAGGAGTTGGATATTACTCGAGTAATATCCAACTCCTCAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098035    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007879.1-1330s1c1
Sequence:CCGGCCGGAGATAGGGTGTTATGTACTCGAGTACATAACACCCTATCTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007879.1-383s1c1
Sequence:CCGGCCTGGTGTCATCAGATATAAACTCGAGTTTATATCTGATGACACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007879.1-975s1c1
Sequence:CCGGGCCAGTTACCAGATTACACATCTCGAGATGTGTAATCTGGTAACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007879.1-537s1c1
Sequence:CCGGCCTTGGGACATAAGAAGATAACTCGAGTTATCTTCTTATGTCCCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007879.1-538s1c1
Sequence:CCGGCTTGGGACATAAGAAGATAATCTCGAGATTATCTTCTTATGTCCCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004147
VALIDATED
DRG1 MISSION shRNA Bacterial Glycerol Stock
developmentally regulated GTP binding protein 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000299453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_004147.3-1002s21c1
Sequence:CCGGCTAGTGAGAATTTACACCAAACTCGAGTTTGGTGTAAATTCTCACTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_004147.3-735s21c1
Sequence:CCGGGCTGAAACTGTGAAGAGCATTCTCGAGAATGCTCTTCACAGTTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_004147.3-855s21c1
Sequence:CCGGCCCTGTATCTATGTGTTAAATCTCGAGATTTAACACATAGATACAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_004147.3-584s21c1
Sequence:CCGGCCTGAAACCTTTGGGACATAACTCGAGTTATGTCCCAAAGGTTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_004147.3-438s21c1
Sequence:CCGGCCTGGTGTCATCAGATACAAACTCGAGTTTGTATCTGATGACACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_004147.2-785s1c1
Sequence:CCGGCCCTGTATCTATGTGTTAAATCTCGAGATTTAACACATAGATACAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_004147.2-665s1c1
Sequence:CCGGGCTGAAACTGTGAAGAGCATTCTCGAGAATGCTCTTCACAGTTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004147.2-932s1c1
Sequence:CCGGCTAGTGAGAATTTACACCAAACTCGAGTTTGGTGTAAATTCTCACTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_004147.2-514s1c1
Sequence:CCGGCCTGAAACCTTTGGGACATAACTCGAGTTATGTCCCAAAGGTTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004147.2-368s1c1
Sequence:CCGGCCTGGTGTCATCAGATACAAACTCGAGTTTGTATCTGATGACACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004147
VALIDATED
DRG1 MISSION shRNA shRNA Plasmid DNA
developmentally regulated GTP binding protein 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000299453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_004147.3-1002s21c1
Sequence:CCGGCTAGTGAGAATTTACACCAAACTCGAGTTTGGTGTAAATTCTCACTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_004147.3-735s21c1
Sequence:CCGGGCTGAAACTGTGAAGAGCATTCTCGAGAATGCTCTTCACAGTTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_004147.3-855s21c1
Sequence:CCGGCCCTGTATCTATGTGTTAAATCTCGAGATTTAACACATAGATACAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_004147.3-584s21c1
Sequence:CCGGCCTGAAACCTTTGGGACATAACTCGAGTTATGTCCCAAAGGTTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_004147.3-438s21c1
Sequence:CCGGCCTGGTGTCATCAGATACAAACTCGAGTTTGTATCTGATGACACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_004147.2-785s1c1
Sequence:CCGGCCCTGTATCTATGTGTTAAATCTCGAGATTTAACACATAGATACAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_004147.2-665s1c1
Sequence:CCGGGCTGAAACTGTGAAGAGCATTCTCGAGAATGCTCTTCACAGTTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004147.2-932s1c1
Sequence:CCGGCTAGTGAGAATTTACACCAAACTCGAGTTTGGTGTAAATTCTCACTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_004147.2-514s1c1
Sequence:CCGGCCTGAAACCTTTGGGACATAACTCGAGTTATGTCCCAAAGGTTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004147.2-368s1c1
Sequence:CCGGCCTGGTGTCATCAGATACAAACTCGAGTTTGTATCTGATGACACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004147
VALIDATED
DRG1 MISSION shRNA Lentiviral Transduction Particles
developmentally regulated GTP binding protein 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000299453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_004147.3-1002s21c1
Sequence:CCGGCTAGTGAGAATTTACACCAAACTCGAGTTTGGTGTAAATTCTCACTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_004147.3-735s21c1
Sequence:CCGGGCTGAAACTGTGAAGAGCATTCTCGAGAATGCTCTTCACAGTTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_004147.3-855s21c1
Sequence:CCGGCCCTGTATCTATGTGTTAAATCTCGAGATTTAACACATAGATACAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_004147.3-584s21c1
Sequence:CCGGCCTGAAACCTTTGGGACATAACTCGAGTTATGTCCCAAAGGTTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_004147.3-438s21c1
Sequence:CCGGCCTGGTGTCATCAGATACAAACTCGAGTTTGTATCTGATGACACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_004147.2-785s1c1
Sequence:CCGGCCCTGTATCTATGTGTTAAATCTCGAGATTTAACACATAGATACAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_004147.2-665s1c1
Sequence:CCGGGCTGAAACTGTGAAGAGCATTCTCGAGAATGCTCTTCACAGTTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004147.2-932s1c1
Sequence:CCGGCTAGTGAGAATTTACACCAAACTCGAGTTTGGTGTAAATTCTCACTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_004147.2-514s1c1
Sequence:CCGGCCTGAAACCTTTGGGACATAACTCGAGTTATGTCCCAAAGGTTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004147.2-368s1c1
Sequence:CCGGCCTGGTGTCATCAGATACAAACTCGAGTTTGTATCTGATGACACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)