EMAIL THIS PAGE TO A FRIEND

DUSP10

dual specificity phosphatase 10

141 Gene Product Result for
Synonyms: MKP-5 MKP5
UniProtKB ID: Q9Y6W6, D3DTB4, Q6GSI4, Q9H9Z5
Gene ID:
Human(11221) Summary: Dual specificity protein phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the MAPK superfamily (MAPK/ERK, SAPK/JNK, p38), which is associated with cellular proliferation and differentiation. Different members of this family of dual specificity phosphatases show distinct substrate specificities for MAPKs, different tissue distribution and subcellular localization, and different modes of inducibility of their expression by extracellular stimuli. This gene product binds to and inactivates p38 and SAPK/JNK, but not MAPK/ERK. Its subcellular localization is unique; it is evenly distributed in both the cytoplasm and the nucleus. This gene is widely expressed in various tissues and organs, and its expression is elevated by stress stimuli. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(63953) dual specificity phosphatase 10
Rat(63995) dual specificity phosphatase 10
chicken(421340) dual specificity phosphatase 10
cow(541175) dual specificity phosphatase 10
Horse(100050108) dual specificity phosphatase 10
domestic cat(101096697) dual specificity phosphatase 10
dog(488673) dual specificity phosphatase 10
domestic guinea pig(100733434) dual specificity phosphatase 10
naked mole-rat(101715205) dual specificity phosphatase 10
sheep(101106025) dual specificity phosphatase 10
Domestic Rabbit(100352279) dual specificity phosphatase 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007207 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007207 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007207 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_022019 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022019 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022019 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Related Products

Product # Description Species Add to Cart
 
14-779-M MKP5, active pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007207 siRNAs that have been validated in the lab human pricing
NM_144728 Rosetta Predictions human pricing
NM_144729 Rosetta Predictions human pricing
NM_001105734 Rosetta Predictions rat pricing
NM_022019 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007207 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057831 validated 1318
1 SASI_Hs01_00057830 validated 1461
2 SASI_Hs01_00057829 predicted 1965
3 SASI_Hs01_00057832 predicted 1925
4 SASI_Hs02_00343187 predicted 1213
5 SASI_Hs01_00057833 predicted 1466
6 SASI_Hs01_00057835 predicted 1969
7 SASI_Hs01_00057836 predicted 1946
8 SASI_Hs01_00057838 predicted 1423
9 SASI_Hs02_00343188 predicted 1327
10 SASI_Hs01_00057834 predicted 1982
11 SASI_Hs01_00057837 predicted 1970
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144728 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00052418 predicted 1584
2 SASI_Hs01_00052419 predicted 1079
3 SASI_Hs01_00052420 predicted 944
4 SASI_Hs02_00364684 predicted 943
5 SASI_Hs01_00052421 predicted 1555
6 SASI_Hs01_00052422 predicted 1090
7 SASI_Hs02_00364685 predicted 1087
8 SASI_Hs01_00052427 predicted 1047
9 SASI_Hs02_00364686 predicted 957
10 SASI_Hs02_00364687 predicted 1086
11 SASI_Hs01_00052423 predicted 1609
12 SASI_Hs01_00052424 predicted 1605
13 SASI_Hs01_00052425 predicted 1573
14 SASI_Hs01_00052426 predicted 1599
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144729 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224323 predicted 1110
2 SASI_Hs01_00224324 predicted 600
3 SASI_Hs01_00224325 predicted 464
4 SASI_Hs02_00364688 predicted 464
5 SASI_Hs01_00224326 predicted 1077
6 SASI_Hs01_00224327 predicted 612
7 SASI_Hs02_00364689 predicted 609
8 SASI_Hs01_00224332 predicted 575
9 SASI_Hs02_00364690 predicted 471
10 SASI_Hs02_00364691 predicted 607
11 SASI_Hs01_00224328 predicted 1129
12 SASI_Hs01_00224329 predicted 1126
13 SASI_Hs01_00224330 predicted 1094
14 SASI_Hs01_00224331 predicted 1123
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105734 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212006 predicted 904
2 SASI_Rn02_00212007 predicted 818
3 SASI_Rn02_00212008 predicted 486
4 SASI_Rn02_00212009 predicted 1295
5 SASI_Rn02_00212010 predicted 1304
6 SASI_Rn02_00212011 predicted 1236
7 SASI_Rn02_00212012 predicted 1465
8 SASI_Rn02_00212013 predicted 795
9 SASI_Rn02_00212014 predicted 270
10 SASI_Rn02_00212015 predicted 684
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022019 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00120090 predicted 483
2 SASI_Mm01_00120091 predicted 483
3 SASI_Mm01_00120093 predicted 766
4 SASI_Mm01_00120094 predicted 900
5 SASI_Mm01_00120095 predicted 831
6 SASI_Mm01_00120096 predicted 835
7 SASI_Mm01_00120097 predicted 720
8 SASI_Mm01_00120098 predicted 788
9 SASI_Mm01_00120099 predicted 1144
10 SASI_Mm02_00326493 predicted 691
11 SASI_Mm01_00120092 predicted 993
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007207
VALIDATED
DUSP10 MISSION shRNA Bacterial Glycerol Stock
dual specificity phosphatase 10
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000001885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007207.x-902s1c1
Sequence:CCGGCAATGAACCAAGCCGAGTGATCTCGAGATCACTCGGCTTGGTTCATTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001887    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007207.x-2568s1c1
Sequence:CCGGGTGTTTCTGTTGATTGTGTAACTCGAGTTACACAATCAACAGAAACACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007207.x-553s1c1
Sequence:CCGGCAGGCTCTCTAAGTCCATCAACTCGAGTTGATGGACTTAGAGAGCCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007207.x-1265s1c1
Sequence:CCGGCCACTATGAGAAAGGCCTGTTCTCGAGAACAGGCCTTTCTCATAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007207.x-1496s1c1
Sequence:CCGGCAAAGGCAAACGACCAATTATCTCGAGATAATTGGTCGTTTGCCTTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007207.3-758s21c1
Sequence:GTACCGGCCACATTAACTGTGCCGATAACTCGAGTTATCGGCACAGTTAATGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007207.3-1469s21c1
Sequence:GTACCGGGACCATGACTGATGCTTATAACTCGAGTTATAAGCATCAGTCATGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007207.3-345s21c1
Sequence:CCGGGCTGCGAATCTGACGTATATGCTCGAGCATATACGTCAGATTCGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007207.3-1495s21c1
Sequence:CCGGTCAAAGGCAAACGACCAATTACTCGAGTAATTGGTCGTTTGCCTTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314700    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007207.3-1781s21c1
Sequence:CCGGCAAGTGTAAGAAGACTATAACCTCGAGGTTATAGTCTTCTTACACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007207.3-1324s21c1
Sequence:CCGGAGAACCTGCGGCAGTACTTTGCTCGAGCAAAGTACTGCCGCAGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007207.3-902s21c1
Sequence:CCGGCAATGAACCAAGCCGAGTGATCTCGAGATCACTCGGCTTGGTTCATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007207
VALIDATED
DUSP10 MISSION shRNA shRNA Plasmid DNA
dual specificity phosphatase 10
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000001885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007207.x-902s1c1
Sequence:CCGGCAATGAACCAAGCCGAGTGATCTCGAGATCACTCGGCTTGGTTCATTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001887    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007207.x-2568s1c1
Sequence:CCGGGTGTTTCTGTTGATTGTGTAACTCGAGTTACACAATCAACAGAAACACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007207.x-553s1c1
Sequence:CCGGCAGGCTCTCTAAGTCCATCAACTCGAGTTGATGGACTTAGAGAGCCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007207.x-1265s1c1
Sequence:CCGGCCACTATGAGAAAGGCCTGTTCTCGAGAACAGGCCTTTCTCATAGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007207.x-1496s1c1
Sequence:CCGGCAAAGGCAAACGACCAATTATCTCGAGATAATTGGTCGTTTGCCTTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007207.3-758s21c1
Sequence:GTACCGGCCACATTAACTGTGCCGATAACTCGAGTTATCGGCACAGTTAATGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007207.3-1469s21c1
Sequence:GTACCGGGACCATGACTGATGCTTATAACTCGAGTTATAAGCATCAGTCATGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007207.3-345s21c1
Sequence:CCGGGCTGCGAATCTGACGTATATGCTCGAGCATATACGTCAGATTCGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007207.3-1495s21c1
Sequence:CCGGTCAAAGGCAAACGACCAATTACTCGAGTAATTGGTCGTTTGCCTTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314700    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007207.3-1781s21c1
Sequence:CCGGCAAGTGTAAGAAGACTATAACCTCGAGGTTATAGTCTTCTTACACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007207.3-1324s21c1
Sequence:CCGGAGAACCTGCGGCAGTACTTTGCTCGAGCAAAGTACTGCCGCAGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007207.3-902s21c1
Sequence:CCGGCAATGAACCAAGCCGAGTGATCTCGAGATCACTCGGCTTGGTTCATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007207
VALIDATED
DUSP10 MISSION shRNA Lentiviral Transduction Particles
dual specificity phosphatase 10
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000001885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007207.x-902s1c1
Sequence:CCGGCAATGAACCAAGCCGAGTGATCTCGAGATCACTCGGCTTGGTTCATTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001887    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007207.x-2568s1c1
Sequence:CCGGGTGTTTCTGTTGATTGTGTAACTCGAGTTACACAATCAACAGAAACACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007207.x-553s1c1
Sequence:CCGGCAGGCTCTCTAAGTCCATCAACTCGAGTTGATGGACTTAGAGAGCCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007207.x-1265s1c1
Sequence:CCGGCCACTATGAGAAAGGCCTGTTCTCGAGAACAGGCCTTTCTCATAGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007207.x-1496s1c1
Sequence:CCGGCAAAGGCAAACGACCAATTATCTCGAGATAATTGGTCGTTTGCCTTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007207.3-758s21c1
Sequence:GTACCGGCCACATTAACTGTGCCGATAACTCGAGTTATCGGCACAGTTAATGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007207.3-1469s21c1
Sequence:GTACCGGGACCATGACTGATGCTTATAACTCGAGTTATAAGCATCAGTCATGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007207.3-345s21c1
Sequence:CCGGGCTGCGAATCTGACGTATATGCTCGAGCATATACGTCAGATTCGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007207.3-1495s21c1
Sequence:CCGGTCAAAGGCAAACGACCAATTACTCGAGTAATTGGTCGTTTGCCTTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314700    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007207.3-1781s21c1
Sequence:CCGGCAAGTGTAAGAAGACTATAACCTCGAGGTTATAGTCTTCTTACACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007207.3-1324s21c1
Sequence:CCGGAGAACCTGCGGCAGTACTTTGCTCGAGCAAAGTACTGCCGCAGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007207.3-902s21c1
Sequence:CCGGCAATGAACCAAGCCGAGTGATCTCGAGATCACTCGGCTTGGTTCATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022019
DUSP10 MISSION shRNA Bacterial Glycerol Stock
dual specificity phosphatase 10
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081108    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022019.2-1671s1c1
Sequence:CCGGCGCTCTTCTTTCCTTTCCTTTCTCGAGAAAGGAAAGGAAAGAAGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022019.2-220s1c1
Sequence:CCGGCCTTTGTTTAGACTCAAGCTACTCGAGTAGCTTGAGTCTAAACAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022019.2-1551s1c1
Sequence:CCGGCGCCAAGAATCCTTACACCAACTCGAGTTGGTGTAAGGATTCTTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022019.2-727s1c1
Sequence:CCGGCCACATTAACTGTGCCGATAACTCGAGTTATCGGCACAGTTAATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022019.2-613s1c1
Sequence:CCGGCCTGGCAAAGAAGATGACCAACTCGAGTTGGTCATCTTCTTTGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022019.5-780s21c1
Sequence:CCGGCACTGTCTTAGACTTGATTTCCTCGAGGAAATCAAGTCTAAGACAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022019.5-1519s21c1
Sequence:CCGGGAATTTGAGGAAGACCTAAACCTCGAGGTTTAGGTCTTCCTCAAATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022019.5-1448s21c1
Sequence:CCGGACGCTTACAAATTCGTCAAAGCTCGAGCTTTGACGAATTTGTAAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340325    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022019.5-1873s21c1
Sequence:CCGGTGGTATTGCAGTTAGGTTAAACTCGAGTTTAACCTAACTGCAATACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022019.5-1219s21c1
Sequence:CCGGCACCTTCCTCTGTACCATTATCTCGAGATAATGGTACAGAGGAAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022019.5-1292s21c1
Sequence:CCGGAGAACCTGCGGCAGTACTTTGCTCGAGCAAAGTACTGCCGCAGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022019
DUSP10 MISSION shRNA shRNA Plasmid DNA
dual specificity phosphatase 10
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081108    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022019.2-1671s1c1
Sequence:CCGGCGCTCTTCTTTCCTTTCCTTTCTCGAGAAAGGAAAGGAAAGAAGAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022019.2-220s1c1
Sequence:CCGGCCTTTGTTTAGACTCAAGCTACTCGAGTAGCTTGAGTCTAAACAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022019.2-1551s1c1
Sequence:CCGGCGCCAAGAATCCTTACACCAACTCGAGTTGGTGTAAGGATTCTTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022019.2-727s1c1
Sequence:CCGGCCACATTAACTGTGCCGATAACTCGAGTTATCGGCACAGTTAATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022019.2-613s1c1
Sequence:CCGGCCTGGCAAAGAAGATGACCAACTCGAGTTGGTCATCTTCTTTGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022019.5-780s21c1
Sequence:CCGGCACTGTCTTAGACTTGATTTCCTCGAGGAAATCAAGTCTAAGACAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022019.5-1519s21c1
Sequence:CCGGGAATTTGAGGAAGACCTAAACCTCGAGGTTTAGGTCTTCCTCAAATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022019.5-1448s21c1
Sequence:CCGGACGCTTACAAATTCGTCAAAGCTCGAGCTTTGACGAATTTGTAAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340325    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022019.5-1873s21c1
Sequence:CCGGTGGTATTGCAGTTAGGTTAAACTCGAGTTTAACCTAACTGCAATACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022019.5-1219s21c1
Sequence:CCGGCACCTTCCTCTGTACCATTATCTCGAGATAATGGTACAGAGGAAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022019.5-1292s21c1
Sequence:CCGGAGAACCTGCGGCAGTACTTTGCTCGAGCAAAGTACTGCCGCAGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022019
DUSP10 MISSION shRNA Lentiviral Transduction Particles
dual specificity phosphatase 10
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081108    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022019.2-1671s1c1
Sequence:CCGGCGCTCTTCTTTCCTTTCCTTTCTCGAGAAAGGAAAGGAAAGAAGAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022019.2-220s1c1
Sequence:CCGGCCTTTGTTTAGACTCAAGCTACTCGAGTAGCTTGAGTCTAAACAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022019.2-1551s1c1
Sequence:CCGGCGCCAAGAATCCTTACACCAACTCGAGTTGGTGTAAGGATTCTTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022019.2-727s1c1
Sequence:CCGGCCACATTAACTGTGCCGATAACTCGAGTTATCGGCACAGTTAATGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022019.2-613s1c1
Sequence:CCGGCCTGGCAAAGAAGATGACCAACTCGAGTTGGTCATCTTCTTTGCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022019.5-780s21c1
Sequence:CCGGCACTGTCTTAGACTTGATTTCCTCGAGGAAATCAAGTCTAAGACAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022019.5-1519s21c1
Sequence:CCGGGAATTTGAGGAAGACCTAAACCTCGAGGTTTAGGTCTTCCTCAAATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022019.5-1448s21c1
Sequence:CCGGACGCTTACAAATTCGTCAAAGCTCGAGCTTTGACGAATTTGTAAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340325    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022019.5-1873s21c1
Sequence:CCGGTGGTATTGCAGTTAGGTTAAACTCGAGTTTAACCTAACTGCAATACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022019.5-1219s21c1
Sequence:CCGGCACCTTCCTCTGTACCATTATCTCGAGATAATGGTACAGAGGAAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022019.5-1292s21c1
Sequence:CCGGAGAACCTGCGGCAGTACTTTGCTCGAGCAAAGTACTGCCGCAGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)