EMAIL THIS PAGE TO A FRIEND

DUSP9

dual specificity phosphatase 9

69 Gene Product Result for
Synonyms: MKP-4 MKP4
UniProtKB ID: Q99956, D3DWU5
Gene ID:
Human(1852) Summary: The protein encoded by this gene is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mitogen-activated protein (MAP) kinase superfamily (MAPK/ERK, SAPK/JNK, p38), which is associated with cellular proliferation and differentiation. Different members of the family of dual specificity phosphatases show distinct substrate specificities for various MAP kinases, different tissue distribution and subcellular localization, and different modes of inducibility of their expression by extracellular stimuli. This gene product shows selectivity for members of the ERK family of MAP kinases, is expressed only in placenta, kidney, and fetal liver, and is localized to the cytoplasm and nucleus. [provided by RefSeq, Jul 2008]
Mouse(75590) dual specificity phosphatase 9
Rat(293847) dual specificity phosphatase 9
cow(614306) dual specificity phosphatase 9
dog(492240) dual specificity phosphatase 9
domestic cat(101080951) dual specificity phosphatase 9
sheep(101123448) dual specificity phosphatase 9
domestic guinea pig(100713707) dual specificity phosphatase 9
naked mole-rat(101717115) dual specificity phosphatase 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001395 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001395 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001395 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029352 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029352 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029352 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001395 Rosetta Predictions human pricing
NM_001037973 Rosetta Predictions rat pricing
NM_029352 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001395 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00112323 predicted 1016
2 SASI_Hs01_00112324 predicted 913
3 SASI_Hs01_00112325 predicted 981
4 SASI_Hs01_00112326 predicted 932
5 SASI_Hs01_00112327 predicted 845
6 SASI_Hs01_00112328 predicted 880
7 SASI_Hs01_00112329 predicted 979
8 SASI_Hs01_00112330 predicted 1016
9 SASI_Hs01_00112331 predicted 894
10 SASI_Hs01_00112332 predicted 921
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037973 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00090813 predicted 1823
2 SASI_Rn01_00090814 predicted 580
3 SASI_Rn01_00090815 predicted 957
4 SASI_Rn01_00090816 predicted 807
5 SASI_Rn01_00090817 predicted 1924
6 SASI_Rn01_00090818 predicted 1944
7 SASI_Rn01_00090819 predicted 989
8 SASI_Rn01_00090820 predicted 1092
9 SASI_Rn01_00090821 predicted 1290
10 SASI_Rn01_00090822 predicted 383
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029352 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00171865 predicted 1252
2 SASI_Mm01_00171866 predicted 941
3 SASI_Mm01_00171867 predicted 465
4 SASI_Mm01_00171868 predicted 1089
5 SASI_Mm01_00171869 predicted 595
6 SASI_Mm01_00171870 predicted 1121
7 SASI_Mm01_00171871 predicted 1117
8 SASI_Mm01_00171872 predicted 521
9 SASI_Mm01_00171873 predicted 2056
10 SASI_Mm02_00335220 predicted 1975
11 SASI_Mm01_00171864 predicted 934
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001395
VALIDATED
DUSP9 MISSION shRNA Bacterial Glycerol Stock
dual specificity phosphatase 9
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001395.x-1025s1c1
Sequence:CCGGCCTCATGCAGAAGCTCCACCTCTCGAGAGGTGGAGCTTCTGCATGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_001395.x-998s1c1
Sequence:CCGGCCGTTCTGTCACCGTCACTGTCTCGAGACAGTGACGGTGACAGAACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002428    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001395.x-2199s1c1
Sequence:CCGGGAGGATCTATGCTTGTTTGTTCTCGAGAACAAACAAGCATAGATCCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001395.x-1044s1c1
Sequence:CCGGCTCTCTCTCAACGATGCCTATCTCGAGATAGGCATCGTTGAGAGAGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001395.x-491s1c1
Sequence:CCGGCTTCAGCAGATTCCAGGCCGACTCGAGTCGGCCTGGAATCTGCTGAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368293    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001395.2-1758s21c1
Sequence:CCGGGTGTTGTCACCTCCCTGTTTCCTCGAGGAAACAGGGAGGTGACAACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001395.2-711s21c1
Sequence:CCGGCGACTGCTCTGATGCGGAATCCTCGAGGATTCCGCATCAGAGCAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001395.2-882s21c1
Sequence:CCGGCAAACTGGGCATCCGCTACATCTCGAGATGTAGCGGATGCCCAGTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001395.2-1136s21c1
Sequence:CCGGTCTCTCTCAACGATGCCTATGCTCGAGCATAGGCATCGTTGAGAGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001395.2-1013s21c1
Sequence:CCGGCGGAGGCCATTGAGTTCATTGCTCGAGCAATGAACTCAATGGCCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235398    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001395.2-2118s21c1
Sequence:CCGGGACACACACAGTCATTCATTTCTCGAGAAATGAATGACTGTGTGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001395.2-933s21c1
Sequence:CCGGCTTCGAGAAGAATGGTGACTTCTCGAGAAGTCACCATTCTTCTCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001395.2-821s21c1
Sequence:CCGGAGATCCTGCCCAACCTCTATCCTCGAGGATAGAGGTTGGGCAGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001395
VALIDATED
DUSP9 MISSION shRNA shRNA Plasmid DNA
dual specificity phosphatase 9
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001395.x-1025s1c1
Sequence:CCGGCCTCATGCAGAAGCTCCACCTCTCGAGAGGTGGAGCTTCTGCATGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_001395.x-998s1c1
Sequence:CCGGCCGTTCTGTCACCGTCACTGTCTCGAGACAGTGACGGTGACAGAACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002428    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001395.x-2199s1c1
Sequence:CCGGGAGGATCTATGCTTGTTTGTTCTCGAGAACAAACAAGCATAGATCCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001395.x-1044s1c1
Sequence:CCGGCTCTCTCTCAACGATGCCTATCTCGAGATAGGCATCGTTGAGAGAGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001395.x-491s1c1
Sequence:CCGGCTTCAGCAGATTCCAGGCCGACTCGAGTCGGCCTGGAATCTGCTGAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368293    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001395.2-1758s21c1
Sequence:CCGGGTGTTGTCACCTCCCTGTTTCCTCGAGGAAACAGGGAGGTGACAACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001395.2-711s21c1
Sequence:CCGGCGACTGCTCTGATGCGGAATCCTCGAGGATTCCGCATCAGAGCAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001395.2-882s21c1
Sequence:CCGGCAAACTGGGCATCCGCTACATCTCGAGATGTAGCGGATGCCCAGTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001395.2-1136s21c1
Sequence:CCGGTCTCTCTCAACGATGCCTATGCTCGAGCATAGGCATCGTTGAGAGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001395.2-1013s21c1
Sequence:CCGGCGGAGGCCATTGAGTTCATTGCTCGAGCAATGAACTCAATGGCCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235398    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001395.2-2118s21c1
Sequence:CCGGGACACACACAGTCATTCATTTCTCGAGAAATGAATGACTGTGTGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001395.2-933s21c1
Sequence:CCGGCTTCGAGAAGAATGGTGACTTCTCGAGAAGTCACCATTCTTCTCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001395.2-821s21c1
Sequence:CCGGAGATCCTGCCCAACCTCTATCCTCGAGGATAGAGGTTGGGCAGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001395
VALIDATED
DUSP9 MISSION shRNA Lentiviral Transduction Particles
dual specificity phosphatase 9
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001395.x-1025s1c1
Sequence:CCGGCCTCATGCAGAAGCTCCACCTCTCGAGAGGTGGAGCTTCTGCATGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_001395.x-998s1c1
Sequence:CCGGCCGTTCTGTCACCGTCACTGTCTCGAGACAGTGACGGTGACAGAACGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002428    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001395.x-2199s1c1
Sequence:CCGGGAGGATCTATGCTTGTTTGTTCTCGAGAACAAACAAGCATAGATCCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001395.x-1044s1c1
Sequence:CCGGCTCTCTCTCAACGATGCCTATCTCGAGATAGGCATCGTTGAGAGAGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001395.x-491s1c1
Sequence:CCGGCTTCAGCAGATTCCAGGCCGACTCGAGTCGGCCTGGAATCTGCTGAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368293    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001395.2-1758s21c1
Sequence:CCGGGTGTTGTCACCTCCCTGTTTCCTCGAGGAAACAGGGAGGTGACAACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001395.2-711s21c1
Sequence:CCGGCGACTGCTCTGATGCGGAATCCTCGAGGATTCCGCATCAGAGCAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001395.2-882s21c1
Sequence:CCGGCAAACTGGGCATCCGCTACATCTCGAGATGTAGCGGATGCCCAGTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001395.2-1136s21c1
Sequence:CCGGTCTCTCTCAACGATGCCTATGCTCGAGCATAGGCATCGTTGAGAGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001395.2-1013s21c1
Sequence:CCGGCGGAGGCCATTGAGTTCATTGCTCGAGCAATGAACTCAATGGCCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235398    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001395.2-2118s21c1
Sequence:CCGGGACACACACAGTCATTCATTTCTCGAGAAATGAATGACTGTGTGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001395.2-933s21c1
Sequence:CCGGCTTCGAGAAGAATGGTGACTTCTCGAGAAGTCACCATTCTTCTCGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001395.2-821s21c1
Sequence:CCGGAGATCCTGCCCAACCTCTATCCTCGAGGATAGAGGTTGGGCAGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029352
VALIDATED
DUSP9 MISSION shRNA Bacterial Glycerol Stock
dual specificity phosphatase 9
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081018    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029352.3-1956s1c1
Sequence:CCGGGCCCTTCTTGCTGTTTCATTTCTCGAGAAATGAAACAGCAAGAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029352.3-1421s1c1
Sequence:CCGGCTCACCTAACTTCAACTTTATCTCGAGATAAAGTTGAAGTTAGGTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029352.3-932s1c1
Sequence:CCGGCCTGTGCTTGAGCTCTGATTTCTCGAGAAATCAGAGCTCAAGCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029352.3-1161s1c1
Sequence:CCGGCCTAACCTCTTTGAGAAGAATCTCGAGATTCTTCTCAAAGAGGTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029352.3-1226s1c1
Sequence:CCGGCCAGAATCTGTCCCAGTTCTTCTCGAGAAGAACTGGGACAGATTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029352.3-1421s21c1
Sequence:CCGGCTCACCTAACTTCAACTTTATCTCGAGATAAAGTTGAAGTTAGGTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029352.3-932s21c1
Sequence:CCGGCCTGTGCTTGAGCTCTGATTTCTCGAGAAATCAGAGCTCAAGCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029352.3-1161s21c1
Sequence:CCGGCCTAACCTCTTTGAGAAGAATCTCGAGATTCTTCTCAAAGAGGTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029352.3-1226s21c1
Sequence:CCGGCCAGAATCTGTCCCAGTTCTTCTCGAGAAGAACTGGGACAGATTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309781    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029352.3-1956s21c1
Sequence:CCGGGCCCTTCTTGCTGTTTCATTTCTCGAGAAATGAAACAGCAAGAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029352
VALIDATED
DUSP9 MISSION shRNA shRNA Plasmid DNA
dual specificity phosphatase 9
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081018    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029352.3-1956s1c1
Sequence:CCGGGCCCTTCTTGCTGTTTCATTTCTCGAGAAATGAAACAGCAAGAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029352.3-1421s1c1
Sequence:CCGGCTCACCTAACTTCAACTTTATCTCGAGATAAAGTTGAAGTTAGGTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029352.3-932s1c1
Sequence:CCGGCCTGTGCTTGAGCTCTGATTTCTCGAGAAATCAGAGCTCAAGCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029352.3-1161s1c1
Sequence:CCGGCCTAACCTCTTTGAGAAGAATCTCGAGATTCTTCTCAAAGAGGTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029352.3-1226s1c1
Sequence:CCGGCCAGAATCTGTCCCAGTTCTTCTCGAGAAGAACTGGGACAGATTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029352.3-1421s21c1
Sequence:CCGGCTCACCTAACTTCAACTTTATCTCGAGATAAAGTTGAAGTTAGGTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029352.3-932s21c1
Sequence:CCGGCCTGTGCTTGAGCTCTGATTTCTCGAGAAATCAGAGCTCAAGCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029352.3-1161s21c1
Sequence:CCGGCCTAACCTCTTTGAGAAGAATCTCGAGATTCTTCTCAAAGAGGTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029352.3-1226s21c1
Sequence:CCGGCCAGAATCTGTCCCAGTTCTTCTCGAGAAGAACTGGGACAGATTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309781    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029352.3-1956s21c1
Sequence:CCGGGCCCTTCTTGCTGTTTCATTTCTCGAGAAATGAAACAGCAAGAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029352
VALIDATED
DUSP9 MISSION shRNA Lentiviral Transduction Particles
dual specificity phosphatase 9
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081018    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029352.3-1956s1c1
Sequence:CCGGGCCCTTCTTGCTGTTTCATTTCTCGAGAAATGAAACAGCAAGAAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029352.3-1421s1c1
Sequence:CCGGCTCACCTAACTTCAACTTTATCTCGAGATAAAGTTGAAGTTAGGTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029352.3-932s1c1
Sequence:CCGGCCTGTGCTTGAGCTCTGATTTCTCGAGAAATCAGAGCTCAAGCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029352.3-1161s1c1
Sequence:CCGGCCTAACCTCTTTGAGAAGAATCTCGAGATTCTTCTCAAAGAGGTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029352.3-1226s1c1
Sequence:CCGGCCAGAATCTGTCCCAGTTCTTCTCGAGAAGAACTGGGACAGATTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029352.3-1421s21c1
Sequence:CCGGCTCACCTAACTTCAACTTTATCTCGAGATAAAGTTGAAGTTAGGTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029352.3-932s21c1
Sequence:CCGGCCTGTGCTTGAGCTCTGATTTCTCGAGAAATCAGAGCTCAAGCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029352.3-1161s21c1
Sequence:CCGGCCTAACCTCTTTGAGAAGAATCTCGAGATTCTTCTCAAAGAGGTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029352.3-1226s21c1
Sequence:CCGGCCAGAATCTGTCCCAGTTCTTCTCGAGAAGAACTGGGACAGATTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309781    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029352.3-1956s21c1
Sequence:CCGGGCCCTTCTTGCTGTTTCATTTCTCGAGAAATGAAACAGCAAGAAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)