EMAIL THIS PAGE TO A FRIEND

DUX4L12

double homeobox 4 like 12

10 Gene Product Result for
Species: Human DUX4L12(440014)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_495855 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_495855 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_495855 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_495855 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_495855 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00479909 predicted 563
2 SASI_Hs02_00479910 predicted 563
3 SASI_Hs02_00479911 predicted 561
4 SASI_Hs02_00479912 predicted 1140
5 SASI_Hs02_00479913 predicted 1371
6 SASI_Hs02_00479914 predicted 562
7 SASI_Hs02_00479915 predicted 590
8 SASI_Hs02_00479916 predicted 1042
9 SASI_Hs02_00479917 predicted 1068
10 SASI_Hs02_00479918 predicted 575
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_495855
DUX4L12 MISSION shRNA Bacterial Glycerol Stock
double homeobox 4 like 12
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_495855.4-1435s21c1
Sequence:CCGGTTTCTGCAGCAGGCGCAACCTCTCGAGAGGTTGCGCCTGCTGCAGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_495855.4-712s21c1
Sequence:CCGGATCTGGTTTCAGAATCGAAGGCTCGAGCCTTCGATTCTGAAACCAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_495855.4-403s21c1
Sequence:CCGGTGCTTTGAGCGGAACCCGTACCTCGAGGTACGGGTTCCGCTCAAAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_495855.4-618s21c1
Sequence:CCGGGCTCCTCCGAGCCTTTGAGAACTCGAGTTCTCAAAGGCTCGGAGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_495855.4-491s21c1
Sequence:CCGGGGTTTCAGAATGAGAGGTCACCTCGAGGTGACCTCTCATTCTGAAACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_495855
DUX4L12 MISSION shRNA shRNA Plasmid DNA
double homeobox 4 like 12
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_495855.4-1435s21c1
Sequence:CCGGTTTCTGCAGCAGGCGCAACCTCTCGAGAGGTTGCGCCTGCTGCAGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_495855.4-712s21c1
Sequence:CCGGATCTGGTTTCAGAATCGAAGGCTCGAGCCTTCGATTCTGAAACCAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_495855.4-403s21c1
Sequence:CCGGTGCTTTGAGCGGAACCCGTACCTCGAGGTACGGGTTCCGCTCAAAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_495855.4-618s21c1
Sequence:CCGGGCTCCTCCGAGCCTTTGAGAACTCGAGTTCTCAAAGGCTCGGAGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_495855.4-491s21c1
Sequence:CCGGGGTTTCAGAATGAGAGGTCACCTCGAGGTGACCTCTCATTCTGAAACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_495855
DUX4L12 MISSION shRNA Lentiviral Transduction Particles
double homeobox 4 like 12
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_495855.4-1435s21c1
Sequence:CCGGTTTCTGCAGCAGGCGCAACCTCTCGAGAGGTTGCGCCTGCTGCAGAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_495855.4-712s21c1
Sequence:CCGGATCTGGTTTCAGAATCGAAGGCTCGAGCCTTCGATTCTGAAACCAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_495855.4-403s21c1
Sequence:CCGGTGCTTTGAGCGGAACCCGTACCTCGAGGTACGGGTTCCGCTCAAAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_495855.4-618s21c1
Sequence:CCGGGCTCCTCCGAGCCTTTGAGAACTCGAGTTCTCAAAGGCTCGGAGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_495855.4-491s21c1
Sequence:CCGGGGTTTCAGAATGAGAGGTCACCTCGAGGTGACCTCTCATTCTGAAACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)