EMAIL THIS PAGE TO A FRIEND

DUX4L9

double homeobox 4 like 9

20 Gene Product Result for
Synonyms: DUX4C
Species: Human DUX4L9(554045)
UniProtKB ID: Q6RFH8
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001023569 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001023569 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001023569 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001023569 Rosetta Predictions human pricing
XR_041197 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001023569 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063756 predicted 274
2 SASI_Hs01_00063757 predicted 289
3 SASI_Hs01_00063758 predicted 277
4 SASI_Hs01_00063759 predicted 272
5 SASI_Hs01_00063760 predicted 780
6 SASI_Hs01_00063761 predicted 853
7 SASI_Hs01_00063762 predicted 773
8 SASI_Hs01_00063763 predicted 268
9 SASI_Hs01_00063764 predicted 303
10 SASI_Hs01_00063765 predicted 756
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041197 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00525462 predicted 1416
2 SASI_Hs02_00525463 predicted 1460
3 SASI_Hs02_00525464 predicted 1545
4 SASI_Hs02_00525465 predicted 1108
5 SASI_Hs02_00525466 predicted 1536
6 SASI_Hs02_00525467 predicted 1083
7 SASI_Hs02_00525468 predicted 1541
8 SASI_Hs02_00525469 predicted 1084
9 SASI_Hs02_00525470 predicted 1040
10 SASI_Hs02_00525471 predicted 1402
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001023569
DUX4L9 MISSION shRNA Bacterial Glycerol Stock
double homeobox 4 like 9
Human
1 Products Total
TRC Number Price Set Price (1)? Select
TRCN0000180718    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001023569.1-405s1c1
Sequence:CCGGGTCCAGGATTCAGATCTGGTTCTCGAGAACCAGATCTGAATCCTGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001023569
DUX4L9 MISSION shRNA shRNA Plasmid DNA
double homeobox 4 like 9
Human
1 Products Total
TRC Number Vector Price Set Price (1)? Select
TRCN0000180718    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001023569.1-405s1c1
Sequence:CCGGGTCCAGGATTCAGATCTGGTTCTCGAGAACCAGATCTGAATCCTGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001023569
DUX4L9 MISSION shRNA Lentiviral Transduction Particles
double homeobox 4 like 9
Human
1 Products Total
TRC Number Volume Titer Vector Price Set Price (1)? Select
TRCN0000180718    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001023569.1-405s1c1
Sequence:CCGGGTCCAGGATTCAGATCTGGTTCTCGAGAACCAGATCTGAATCCTGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)